PSMA6 siRNA

20-abx904308
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMA6 siRNA

20-abx930132
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMA6 siRNA

20-abx930133
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMA6 antibody

70R-4759 50 ug
EUR 467
Description: Rabbit polyclonal PSMA6 antibody

PSMA6 Antibody

ABD6911 100 ug
EUR 438

PSMA6 Antibody

32652-100ul 100ul
EUR 252

PSMA6 antibody

70R-19577 50 ul
EUR 435
Description: Rabbit polyclonal PSMA6 antibody

PSMA6 Antibody

DF6911 200ul
EUR 304
Description: PSMA6 Antibody detects endogenous levels of total PSMA6.

PSMA6 Antibody

1-CSB-PA018871GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PSMA6. Recognizes PSMA6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PSMA6 Conjugated Antibody

C32652 100ul
EUR 397

PSMA6 cloning plasmid

CSB-CL018871HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 741
  • Sequence: atgtcccgtggttccagcgccggttttgaccgccacattaccattttttcacccgagggtcggctctaccaagtagaatatgcttttaaggctattaaccagggtggccttacatcagtagctgtcagagggaaagactgtgcagtaattgtcacacagaagaaagtacctgacaa
  • Show more
Description: A cloning plasmid for the PSMA6 gene.

PSMA6 cloning plasmid

CSB-CL018871HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 741
  • Sequence: atgtcccgtggttccagcgccggttttgaccgccacattaccattttttcacccgagggtcggctctaccaagtagaatatgcttttaaggctattaaccagggtggccttacatcagtagctgtcagagggaaagactgtgcagtaattgtcacacagaagaaagtacctgacaa
  • Show more
Description: A cloning plasmid for the PSMA6 gene.

anti- PSMA6 antibody

FNab06865 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: proteasome (prosome, macropain) subunit, alpha type, 6
  • Uniprot ID: P60900
  • Gene ID: 5687
  • Research Area: Metabolism
Description: Antibody raised against PSMA6

PSMA6 Rabbit pAb

A13536-100ul 100 ul
EUR 308

PSMA6 Rabbit pAb

A13536-200ul 200 ul
EUR 459

PSMA6 Rabbit pAb

A13536-20ul 20 ul
EUR 183

PSMA6 Rabbit pAb

A13536-50ul 50 ul
EUR 223

PSMA6 Rabbit pAb

A2188-100ul 100 ul
EUR 308

PSMA6 Rabbit pAb

A2188-200ul 200 ul
EUR 459

PSMA6 Rabbit pAb

A2188-20ul 20 ul
EUR 183

PSMA6 Rabbit pAb

A2188-50ul 50 ul
EUR 223

PSMA6 Blocking Peptide

33R-2815 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMA6 antibody, catalog no. 70R-4759

PSMA6 Blocking Peptide

DF6911-BP 1mg
EUR 195

Anti-PSMA6 antibody

PAab06865 100 ug
EUR 386

Anti-PSMA6 antibody

STJ25174 100 µl
EUR 277
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple transcript variants encoding several different isoforms have been found for this gene. A pseudogene has been identified on the Y chromosome.

Anti-PSMA6 antibody

STJ115497 100 µl
EUR 277
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple transcript variants encoding several different isoforms have been found for this gene. A pseudogene has been identified on the Y chromosome.

Mouse PSMA6 shRNA Plasmid

20-abx973723
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PSMA6 shRNA Plasmid

20-abx985659
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMA6 ELISA KIT|Human

EF002106 96 Tests
EUR 689

Human PSMA6 shRNA Plasmid

20-abx953834
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMA6 protein (His tag)

80R-2050 50 ug
EUR 424
Description: Recombinant human PSMA6 protein (His tag)

PSMA6 Recombinant Protein (Human)

RP024898 100 ug Ask for price

PSMA6 Recombinant Protein (Human)

RP024901 100 ug Ask for price

PSMA6 Recombinant Protein (Rat)

RP222596 100 ug Ask for price

PSMA6 Recombinant Protein (Mouse)

RP165251 100 ug Ask for price

Polyclonal PSMA6 Antibody (N-Term)

APR04893G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMA6 (N-Term). This antibody is tested and proven to work in the following applications:

Polyclonal PSMA6 Antibody (N-Term)

APR06960G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMA6 (N-Term). This antibody is tested and proven to work in the following applications:

PSMA6 ORF Vector (Human) (pORF)

ORF008300 1.0 ug DNA
EUR 95

PSMA6 ORF Vector (Human) (pORF)

ORF008301 1.0 ug DNA
EUR 95

Psma6 ORF Vector (Rat) (pORF)

ORF074200 1.0 ug DNA
EUR 506

Psma6 ORF Vector (Mouse) (pORF)

ORF055085 1.0 ug DNA
EUR 506

[One Step] PSMA6 Antibody Kit

RK05689 50 ul
EUR 240

PSMA6 sgRNA CRISPR Lentivector set (Human)

K1738901 3 x 1.0 ug
EUR 339

Psma6 sgRNA CRISPR Lentivector set (Mouse)

K4976501 3 x 1.0 ug
EUR 339

Psma6 sgRNA CRISPR Lentivector set (Rat)

K6836001 3 x 1.0 ug
EUR 339

Proteasome Subunit Alpha Type 6 (PSMA6) Antibody

20-abx114764
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome Subunit Alpha Type 6 (PSMA6) Antibody

abx122049-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Proteasome Subunit Alpha Type 6 (PSMA6) Antibody

20-abx001800
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome Subunit Alpha Type 6 (PSMA6) Antibody

20-abx141678
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome Subunit Alpha Type 6 (PSMA6) Antibody

abx236865-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

PSMA6 sgRNA CRISPR Lentivector (Human) (Target 1)

K1738902 1.0 ug DNA
EUR 154

PSMA6 sgRNA CRISPR Lentivector (Human) (Target 2)

K1738903 1.0 ug DNA
EUR 154

PSMA6 sgRNA CRISPR Lentivector (Human) (Target 3)

K1738904 1.0 ug DNA
EUR 154

Psma6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4976502 1.0 ug DNA
EUR 154

Psma6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4976503 1.0 ug DNA
EUR 154