PSMA6

PSMA6 antibody
70R-19577	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal PSMA6 antibody

PSMA6 Antibody
32652-100ul	SAB	100ul	EUR 252.00

PSMA6 Antibody
DF6911	Affbiotech	200ul	EUR 304.00
Description: PSMA6 Antibody detects endogenous levels of total PSMA6.

PSMA6 antibody
70R-4759	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal PSMA6 antibody

PSMA6 Antibody
1-CSB-PA018871GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PSMA6. Recognizes PSMA6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PSMA6 siRNA
20-abx904308	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

PSMA6 siRNA
20-abx930132	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

PSMA6 siRNA
20-abx930133	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

PSMA6 Antibody
ABD6911	Lifescience Market	100 ug	EUR 438.00

PSMA6 Rabbit pAb
A13536-100ul	Abclonal	100 ul	EUR 308.00

PSMA6 Rabbit pAb
A13536-200ul	Abclonal	200 ul	EUR 459.00

PSMA6 Rabbit pAb
A13536-20ul	Abclonal	20 ul	EUR 183.00

PSMA6 Rabbit pAb
A13536-50ul	Abclonal	50 ul	EUR 223.00

PSMA6 Blocking Peptide
33R-2815	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMA6 antibody, catalog no. 70R-4759

PSMA6 Blocking Peptide
DF6911-BP	Affbiotech	1mg	EUR 195.00

PSMA6 Conjugated Antibody
C32652	SAB	100ul	EUR 397.00

PSMA6 cloning plasmid
CSB-CL018871HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 741 Sequence: atgtcccgtggttccagcgccggttttgaccgccacattaccattttttcacccgagggtcggctctaccaagtagaatatgcttttaaggctattaaccagggtggccttacatcagtagctgtcagagggaaagactgtgcagtaattgtcacacagaagaaagtacctgacaa Show more
Description: A cloning plasmid for the PSMA6 gene.

PSMA6 cloning plasmid
CSB-CL018871HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 741 Sequence: atgtcccgtggttccagcgccggttttgaccgccacattaccattttttcacccgagggtcggctctaccaagtagaatatgcttttaaggctattaaccagggtggccttacatcagtagctgtcagagggaaagactgtgcagtaattgtcacacagaagaaagtacctgacaa Show more
Description: A cloning plasmid for the PSMA6 gene.

PSMA6 Rabbit pAb
A2188-100ul	Abclonal	100 ul	EUR 308.00

PSMA6 Rabbit pAb
A2188-200ul	Abclonal	200 ul	EUR 459.00

PSMA6 Rabbit pAb
A2188-20ul	Abclonal	20 ul	EUR 183.00

PSMA6 Rabbit pAb
A2188-50ul	Abclonal	50 ul	EUR 223.00

anti- PSMA6 antibody
FNab06865	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: proteasome (prosome, macropain) subunit, alpha type, 6 Uniprot ID: P60900 Gene ID: 5687 Research Area: Metabolism
Description: Antibody raised against PSMA6

Anti-PSMA6 antibody
PAab06865	Lifescience Market	100 ug	EUR 386.00

Anti-PSMA6 antibody
STJ25174	St John's Laboratory	100 µl	EUR 277.00
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple transcript variants encoding several different isoforms have been found for this gene. A pseudogene has been identified on the Y chromosome.

Anti-PSMA6 antibody
STJ115497	St John's Laboratory	100 µl	EUR 277.00
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple transcript variants encoding several different isoforms have been found for this gene. A pseudogene has been identified on the Y chromosome.

PSMA6 protein (His tag)
80R-2050	Fitzgerald	50 ug	EUR 424.00
Description: Recombinant human PSMA6 protein (His tag)

PSMA6 ELISA KIT|Human
EF002106	Lifescience Market	96 Tests	EUR 689.00

Mouse PSMA6 shRNA Plasmid
20-abx973723	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat PSMA6 shRNA Plasmid
20-abx985659	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human PSMA6 shRNA Plasmid
20-abx953834	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

PSMA6 Recombinant Protein (Human)
RP024898	ABM	100 ug	Ask for price

PSMA6 Recombinant Protein (Human)
RP024901	ABM	100 ug	Ask for price

PSMA6 Recombinant Protein (Mouse)
RP165251	ABM	100 ug	Ask for price

PSMA6 Recombinant Protein (Rat)
RP222596	ABM	100 ug	Ask for price

Polyclonal PSMA6 Antibody (N-Term)
APR04893G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMA6 (N-Term). This antibody is tested and proven to work in the following applications:

Polyclonal PSMA6 Antibody (N-Term)
APR06960G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMA6 (N-Term). This antibody is tested and proven to work in the following applications:

Psma6 ORF Vector (Rat) (pORF)
ORF074200	ABM	1.0 ug DNA	EUR 506.00

PSMA6 ORF Vector (Human) (pORF)
ORF008300	ABM	1.0 ug DNA	EUR 95.00

PSMA6 ORF Vector (Human) (pORF)
ORF008301	ABM	1.0 ug DNA	EUR 95.00

Psma6 ORF Vector (Mouse) (pORF)
ORF055085	ABM	1.0 ug DNA	EUR 506.00

[One Step] PSMA6 Antibody Kit
RK05689	Abclonal	50 ul	EUR 240.00

Psma6 sgRNA CRISPR Lentivector set (Mouse)
K4976501	ABM	3 x 1.0 ug	EUR 339.00

Psma6 sgRNA CRISPR Lentivector set (Rat)
K6836001	ABM	3 x 1.0 ug	EUR 339.00

PSMA6 sgRNA CRISPR Lentivector set (Human)
K1738901	ABM	3 x 1.0 ug	EUR 339.00

Proteasome Subunit Alpha Type 6 (PSMA6) Antibody
20-abx114764	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

Proteasome Subunit Alpha Type 6 (PSMA6) Antibody
abx122049-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Proteasome Subunit Alpha Type 6 (PSMA6) Antibody
20-abx141678	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	0 1 2
Shipped within 5-10 working days.

Proteasome Subunit Alpha Type 6 (PSMA6) Antibody
abx236865-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Proteasome Subunit Alpha Type 6 (PSMA6) Antibody
20-abx001800	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Psma6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4976502	ABM	1.0 ug DNA	EUR 154.00

Psma6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4976503	ABM	1.0 ug DNA	EUR 154.00

Psma6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4976504	ABM	1.0 ug DNA	EUR 154.00

Psma6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6836002	ABM	1.0 ug DNA	EUR 154.00

Psma6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6836003	ABM	1.0 ug DNA	EUR 154.00