PSMB4 antibody

70R-19585 50 ul
EUR 435.00
Description: Rabbit polyclonal PSMB4 antibody

PSMB4 antibody

70R-2343 50 ug
EUR 467.00
Description: Rabbit polyclonal PSMB4 antibody

PSMB4 antibody

70R-2349 50 ug
EUR 467.00
Description: Rabbit polyclonal PSMB4 antibody

PSMB4 antibody

70R-15177 100 ug
EUR 327.00
Description: Rabbit polyclonal PSMB4 antibody

PSMB4 Antibody

32983-100ul 100ul
EUR 252.00

PSMB4 antibody

10R-5477 100 ul
EUR 691.00
Description: Mouse monoclonal PSMB4 antibody

PSMB4 antibody

10R-5478 100 ul
EUR 691.00
Description: Mouse monoclonal PSMB4 antibody

PSMB4 antibody

10R-5479 100 ul
EUR 691.00
Description: Mouse monoclonal PSMB4 antibody

PSMB4 antibody

10R-5480 100 ul
EUR 691.00
Description: Mouse monoclonal PSMB4 antibody

PSMB4 antibody

10R-5481 100 ul
EUR 691.00
Description: Mouse monoclonal PSMB4 antibody

PSMB4 antibody

10R-5482 100 ul
EUR 726.00
Description: Mouse monoclonal PSMB4 antibody

PSMB4 antibody

10R-5483 100 ul
EUR 691.00
Description: Mouse monoclonal PSMB4 antibody

PSMB4 Antibody

DF7465 200ul
EUR 304.00
Description: PSMB4 Antibody detects endogenous levels of total PSMB4.

PSMB4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMB4. Recognizes PSMB4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

PSMB4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PSMB4. Recognizes PSMB4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PSMB4 Antibody

ABD7465 100 ug
EUR 438.00


PVT18324 2 ug
EUR 231.00

PSMB4 Blocking Peptide

33R-10173 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMB4 antibody, catalog no. 70R-2349

PSMB4 Blocking Peptide

33R-8775 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMB4 antibody, catalog no. 70R-2343

PSMB4 Blocking Peptide

DF7465-BP 1mg
EUR 195.00

PSMB4 Conjugated Antibody

C32983 100ul
EUR 397.00

PSMB4 cloning plasmid

CSB-CL018882HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: atggaagcgtttttggggtcgcggtccggactttgggcggggggtccggccccaggacagttttaccgcattccatccactcccgattccttcatggatccggcgtctgcactttacagaggtccaatcacgcggacccagaaccccatggtgaccgggacctcagtcctcggcgt
  • Show more
Description: A cloning plasmid for the PSMB4 gene.

PSMB4 cloning plasmid

CSB-CL018882HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: atggaagcgtttttggggtcgcggtccggactctgggcggggggtccggccccaggacagttttaccgcattccgtccactcccgattccttcatggatccggcgtctgcactttacagaggtccaatcacgcggacccagaaccccatggtgaccgggacctcagtcctcggcgt
  • Show more
Description: A cloning plasmid for the PSMB4 gene.

PSMB4 cloning plasmid

CSB-CL018882HU3-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: atggaagcgtttttggggtcgcggtccggactttgggcggggggtccggccccaggacagttttaccgcattccgtccactcccgattccttcatggatccggcgtctgcactttacagaggtccaatcacgcggacccagaaccccatggtgaccgggacctcagtcctcggcgt
  • Show more
Description: A cloning plasmid for the PSMB4 gene.

PSMB4 cloning plasmid

CSB-CL018882HU4-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: atggaagcgtttttggggtcgcggtccggactttgggcggggggtccggccccaggacagttttaccgcattccgtccactcccgattccttcatggatccggcgtctgcactttacagaggtccaatcacgcggacccagaaccccatggtgaccgggacctcagtcctcggcgt
  • Show more
Description: A cloning plasmid for the PSMB4 gene.

PSMB4 Rabbit pAb

A5697-100ul 100 ul
EUR 308.00

PSMB4 Rabbit pAb

A5697-200ul 200 ul
EUR 459.00

PSMB4 Rabbit pAb

A5697-20ul 20 ul
EUR 183.00

PSMB4 Rabbit pAb

A5697-50ul 50 ul
EUR 223.00

PSMB4 Polyclonal Antibody

A52715 100 µg
EUR 570.55
Description: The best epigenetics products

anti- PSMB4 antibody

FNab06873 100µg
EUR 585.00
  • Immunogen: proteasome(prosome, macropain) subunit, beta type, 4
  • Uniprot ID: P28070
  • Gene ID: 5692
  • Research Area: Metabolism
Description: Antibody raised against PSMB4

Anti-PSMB4 antibody

PAab06873 100 ug
EUR 412.00

Anti-PSMB4 antibody

STJ27664 100 µl
EUR 277.00
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit.

Anti-PSMB4 antibody

STJ72348 100 µg
EUR 359.00

PSMB4 protein (His tag)

80R-2048 50 ug
EUR 424.00
Description: Recombinant human PSMB4 protein (His tag)


EF002115 96 Tests
EUR 689.00

Mouse PSMB4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat PSMB4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

PSMB4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMB4. Recognizes PSMB4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMB4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMB4. Recognizes PSMB4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMB4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMB4. Recognizes PSMB4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human PSMB4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

pCMV-Flag-PSMB4 Plasmid

PVTB00753-2a 2 ug
EUR 356.00

PSMB4 Recombinant Protein (Human)

RP024928 100 ug Ask for price

PSMB4 Recombinant Protein (Human)

RP024931 100 ug Ask for price

PSMB4 Recombinant Protein (Human)

RP024934 100 ug Ask for price

PSMB4 Recombinant Protein (Human)

RP024937 100 ug Ask for price

PSMB4 Recombinant Protein (Mouse)

RP165275 100 ug Ask for price

PSMB4 Recombinant Protein (Rat)

RP222617 100 ug Ask for price

Polyclonal PSMB4 Antibody (internal region)

APG00697G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PSMB4 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal PSMB4 antibody - middle region

APR01318G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMB4 - middle region. This antibody is tested and proven to work in the following applications:

PSMB4 Polyclonal Antibody, FITC Conjugated

A52713 100 µg
EUR 570.55
Description: The best epigenetics products