PSMB4

PSMB4 siRNA
20-abx904313	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

PSMB4 siRNA
20-abx930148	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

PSMB4 siRNA
20-abx930149	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

PSMB4 antibody
70R-2343	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal PSMB4 antibody

PSMB4 antibody
70R-2349	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal PSMB4 antibody

PSMB4 Antibody
ABD7465	Lifescience Market	100 ug	EUR 438.00

PSMB4 Antibody
32983-100ul	SAB	100ul	EUR 252.00

PSMB4 antibody
10R-5477	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal PSMB4 antibody

PSMB4 antibody
10R-5478	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal PSMB4 antibody

PSMB4 antibody
10R-5479	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal PSMB4 antibody

PSMB4 antibody
10R-5480	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal PSMB4 antibody

PSMB4 antibody
10R-5481	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal PSMB4 antibody

PSMB4 antibody
10R-5482	Fitzgerald	100 ul	EUR 726.00
Description: Mouse monoclonal PSMB4 antibody

PSMB4 antibody
10R-5483	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal PSMB4 antibody

PSMB4 antibody
70R-19585	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal PSMB4 antibody

PSMB4 antibody
70R-15177	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal PSMB4 antibody

PSMB4 Antibody
DF7465	Affbiotech	200ul	EUR 304.00
Description: PSMB4 Antibody detects endogenous levels of total PSMB4.

PSMB4 Antibody
1-CSB-PA01374A0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMB4. Recognizes PSMB4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

PSMB4 Antibody
1-CSB-PA018882GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PSMB4. Recognizes PSMB4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

pOTB7-PSMB4
PVT18324	Lifescience Market	2 ug	EUR 231.00

PSMB4 Conjugated Antibody
C32983	SAB	100ul	EUR 397.00

PSMB4 cloning plasmid
CSB-CL018882HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 795 Sequence: atggaagcgtttttggggtcgcggtccggactttgggcggggggtccggccccaggacagttttaccgcattccatccactcccgattccttcatggatccggcgtctgcactttacagaggtccaatcacgcggacccagaaccccatggtgaccgggacctcagtcctcggcgt Show more
Description: A cloning plasmid for the PSMB4 gene.

PSMB4 cloning plasmid
CSB-CL018882HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 795 Sequence: atggaagcgtttttggggtcgcggtccggactctgggcggggggtccggccccaggacagttttaccgcattccgtccactcccgattccttcatggatccggcgtctgcactttacagaggtccaatcacgcggacccagaaccccatggtgaccgggacctcagtcctcggcgt Show more
Description: A cloning plasmid for the PSMB4 gene.

PSMB4 cloning plasmid
CSB-CL018882HU3-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 795 Sequence: atggaagcgtttttggggtcgcggtccggactttgggcggggggtccggccccaggacagttttaccgcattccgtccactcccgattccttcatggatccggcgtctgcactttacagaggtccaatcacgcggacccagaaccccatggtgaccgggacctcagtcctcggcgt Show more
Description: A cloning plasmid for the PSMB4 gene.

PSMB4 cloning plasmid
CSB-CL018882HU4-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 795 Sequence: atggaagcgtttttggggtcgcggtccggactttgggcggggggtccggccccaggacagttttaccgcattccgtccactcccgattccttcatggatccggcgtctgcactttacagaggtccaatcacgcggacccagaaccccatggtgaccgggacctcagtcctcggcgt Show more
Description: A cloning plasmid for the PSMB4 gene.

anti- PSMB4 antibody
FNab06873	FN Test	100µg	EUR 585.00
Immunogen: proteasome(prosome, macropain) subunit, beta type, 4 Uniprot ID: P28070 Gene ID: 5692 Research Area: Metabolism
Description: Antibody raised against PSMB4

PSMB4 Rabbit pAb
A5697-100ul	Abclonal	100 ul	EUR 308.00

PSMB4 Rabbit pAb
A5697-200ul	Abclonal	200 ul	EUR 459.00

PSMB4 Rabbit pAb
A5697-20ul	Abclonal	20 ul	EUR 183.00

PSMB4 Rabbit pAb
A5697-50ul	Abclonal	50 ul	EUR 223.00

PSMB4 Polyclonal Antibody
A52715	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

PSMB4 Blocking Peptide
33R-10173	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMB4 antibody, catalog no. 70R-2349

PSMB4 Blocking Peptide
33R-8775	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMB4 antibody, catalog no. 70R-2343

PSMB4 Blocking Peptide
DF7465-BP	Affbiotech	1mg	EUR 195.00

Anti-PSMB4 antibody
PAab06873	Lifescience Market	100 ug	EUR 412.00

Anti-PSMB4 antibody
STJ72348	St John's Laboratory	100 µg	EUR 359.00

Anti-PSMB4 antibody
STJ27664	St John's Laboratory	100 µl	EUR 277.00
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit.

Rat PSMB4 shRNA Plasmid
20-abx985917	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

PSMB4 ELISA KIT|Human
EF002115	Lifescience Market	96 Tests	EUR 689.00

Human PSMB4 shRNA Plasmid
20-abx953839	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

PSMB4 protein (His tag)
80R-2048	Fitzgerald	50 ug	EUR 424.00
Description: Recombinant human PSMB4 protein (His tag)

Mouse PSMB4 shRNA Plasmid
20-abx972241	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

PSMB4 Antibody, HRP conjugated
1-CSB-PA01374B0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMB4. Recognizes PSMB4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMB4 Antibody, FITC conjugated
1-CSB-PA01374C0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMB4. Recognizes PSMB4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMB4 Antibody, Biotin conjugated
1-CSB-PA01374D0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMB4. Recognizes PSMB4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PSMB4 Recombinant Protein (Human)
RP024928	ABM	100 ug	Ask for price

PSMB4 Recombinant Protein (Human)
RP024931	ABM	100 ug	Ask for price

PSMB4 Recombinant Protein (Human)
RP024934	ABM	100 ug	Ask for price

PSMB4 Recombinant Protein (Human)
RP024937	ABM	100 ug	Ask for price

PSMB4 Recombinant Protein (Rat)
RP222617	ABM	100 ug	Ask for price

pCMV-Flag-PSMB4 Plasmid
PVTB00753-2a	Lifescience Market	2 ug	EUR 356.00

PSMB4 Recombinant Protein (Mouse)
RP165275	ABM	100 ug	Ask for price

Polyclonal PSMB4 antibody - middle region
APR01318G	Leading Biology	0.05mg	EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMB4 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal PSMB4 Antibody (internal region)
APG00697G	Leading Biology	0.1mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PSMB4 (internal region). This antibody is tested and proven to work in the following applications:

PSMB4 Polyclonal Antibody, FITC Conjugated
A52713	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products