PSMC1

PSMC1 antibody
70R-19591	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal PSMC1 antibody

PSMC1 Antibody
36704-100ul	SAB	100ul	EUR 252.00

PSMC1 Antibody
1-CSB-PA098589	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMC1. Recognizes PSMC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

PSMC1 Antibody
1-CSB-PA123862	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMC1. Recognizes PSMC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

PSMC1 Antibody
DF12710	Affbiotech	200ul	EUR 304.00
Description: PSMC1 Antibody detects endogenous levels of PSMC1.

Psmc1 antibody
70R-9398	Fitzgerald	50 ug	EUR 467.00
Description: Affinity purified rabbit polyclonal Psmc1 antibody

PSMC1 Antibody
1-CSB-PA018888GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PSMC1. Recognizes PSMC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PSMC1 siRNA
20-abx904319	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

PSMC1 siRNA
20-abx930160	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

PSMC1 siRNA
20-abx930161	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

pOTB7-PSMC1
PVT18289	Lifescience Market	2 ug	EUR 231.00

PSMC1 Rabbit pAb
A1040-100ul	Abclonal	100 ul	EUR 308.00

PSMC1 Rabbit pAb
A1040-200ul	Abclonal	200 ul	EUR 459.00

PSMC1 Rabbit pAb
A1040-20ul	Abclonal	20 ul	Ask for price

PSMC1 Rabbit pAb
A1040-50ul	Abclonal	50 ul	Ask for price

PSMC1 Rabbit pAb
A15712-100ul	Abclonal	100 ul	EUR 308.00

PSMC1 Rabbit pAb
A15712-200ul	Abclonal	200 ul	EUR 459.00

PSMC1 Rabbit pAb
A15712-20ul	Abclonal	20 ul	EUR 183.00

PSMC1 Rabbit pAb
A15712-50ul	Abclonal	50 ul	EUR 223.00

Psmc1 Blocking Peptide
33R-2542	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Psmc1 antibody, catalog no. 70R-9398

PSMC1 Blocking Peptide
DF12710-BP	Affbiotech	1mg	EUR 195.00

PSMC1 Conjugated Antibody
C36704	SAB	100ul	EUR 397.00

PSMC1 cloning plasmid
CSB-CL018888HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1323 Sequence: atgggtcaaagtcagagtggtggtcatggtcctggaggtggcaagaaggatgacaaggacaagaaaaagaaatatgaacctcctgtaccaactagagtggggaaaaagaagaagaaaacaaagggaccagatgctgccagcaaactgccactggtgacacctcacactcagtgcc Show more
Description: A cloning plasmid for the PSMC1 gene.

PSMC1 cloning plasmid
CSB-CL018888HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1323 Sequence: atgggtcaaagtcagagtggtggtcatggtcctggaggtggcaagaaggatgacaaggacaagaaaaagaaatatgaacctcctgtaccaactagagtggggaaaaagaagaagaaaacaaagggaccagatgctgccagcaaactgccactggtgacacctcacactcagtgcc Show more
Description: A cloning plasmid for the PSMC1 gene.

PSMC1 cloning plasmid
CSB-CL018888HU3-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1323 Sequence: atgggtcaaagtcagagtggtggtcatggtcctggaggtggcaagaaggatgacaaggacaagaaaaagaaatatgaacctcctgtaccaactagagtggggaaaaagaagaagaaaacaaagggaccagatgctgccagcaaactgccactggtgacacctcacactcagtgcc Show more
Description: A cloning plasmid for the PSMC1 gene.

anti- PSMC1 antibody
FNab06877	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:5000 Immunogen: proteasome(prosome, macropain) 26S subunit, ATPase, 1 Uniprot ID: P62191 Gene ID: 5700 Research Area: Neuroscience, Metabolism
Description: Antibody raised against PSMC1

Anti-PSMC1 antibody
PAab06877	Lifescience Market	100 ug	EUR 355.00

Anti-PSMC1 antibody
STJ111058	St John's Laboratory	100 µl	EUR 277.00
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit and a 20S core alpha subunit interact specifically with the hepatitis B virus X protein, a protein critical to viral replication. This subunit also interacts with the adenovirus E1A protein and this interaction alters the activity of the proteasome. Finally, this subunit interacts with ataxin-7, suggesting a role for the proteasome in the development of spinocerebellar ataxia type 7, a progressive neurodegenerative disorder.

Anti-PSMC1 antibody
STJ118172	St John's Laboratory	100 µl	EUR 277.00

PSMC1 ELISA KIT|Human
EF002119	Lifescience Market	96 Tests	EUR 689.00

Mouse PSMC1 shRNA Plasmid
20-abx972245	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat PSMC1 shRNA Plasmid
20-abx987436	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human PSMC1 shRNA Plasmid
20-abx953847	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

PSMC1 Recombinant Protein (Human)
RP024949	ABM	100 ug	Ask for price

PSMC1 Recombinant Protein (Human)
RP024952	ABM	100 ug	Ask for price

PSMC1 Recombinant Protein (Human)
RP024955	ABM	100 ug	Ask for price

PSMC1 Recombinant Protein (Mouse)
RP165293	ABM	100 ug	Ask for price

PSMC1 Recombinant Protein (Rat)
RP222635	ABM	100 ug	Ask for price

Psmc1 ORF Vector (Rat) (pORF)
ORF074213	ABM	1.0 ug DNA	EUR 506.00

PSMC1 ORF Vector (Human) (pORF)
ORF008317	ABM	1.0 ug DNA	EUR 95.00

PSMC1 ORF Vector (Human) (pORF)
ORF008318	ABM	1.0 ug DNA	EUR 95.00

PSMC1 ORF Vector (Human) (pORF)
ORF008319	ABM	1.0 ug DNA	EUR 95.00

Psmc1 ORF Vector (Mouse) (pORF)
ORF055099	ABM	1.0 ug DNA	EUR 506.00

Polyclonal Psmc1 antibody - C-terminal region
APR01319G	Leading Biology	0.05mg	EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Psmc1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Psmc1 sgRNA CRISPR Lentivector set (Rat)
K7082801	ABM	3 x 1.0 ug	EUR 339.00

Psmc1 sgRNA CRISPR Lentivector set (Mouse)
K4691501	ABM	3 x 1.0 ug	EUR 339.00

PSMC1 sgRNA CRISPR Lentivector set (Human)
K1740701	ABM	3 x 1.0 ug	EUR 339.00

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody
20-abx214050	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody
20-abx114740	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody
20-abx123801	Abbexa	EUR 411.00 EUR 592.00	0 1
Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody
20-abx128623	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	0 1 2 3 4
Shipped within 5-7 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody
abx122069-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody
20-abx242173	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody
abx236877-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Psmc1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7082802	ABM	1.0 ug DNA	EUR 154.00