PSMC1 antibody

70R-19591 50 ul
EUR 435
Description: Rabbit polyclonal PSMC1 antibody

PSMC1 Antibody

36704-100ul 100ul
EUR 252

PSMC1 Antibody

1-CSB-PA098589
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMC1. Recognizes PSMC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

PSMC1 Antibody

1-CSB-PA123862
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMC1. Recognizes PSMC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

PSMC1 Antibody

DF12710 200ul
EUR 304
Description: PSMC1 Antibody detects endogenous levels of PSMC1.

Psmc1 antibody

70R-9398 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Psmc1 antibody

PSMC1 Antibody

1-CSB-PA018888GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PSMC1. Recognizes PSMC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PSMC1 siRNA

20-abx904319
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMC1 siRNA

20-abx930160
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMC1 siRNA

20-abx930161
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-PSMC1

PVT18289 2 ug
EUR 231

PSMC1 Rabbit pAb

A1040-100ul 100 ul
EUR 308

PSMC1 Rabbit pAb

A1040-200ul 200 ul
EUR 459

PSMC1 Rabbit pAb

A1040-20ul 20 ul Ask for price

PSMC1 Rabbit pAb

A1040-50ul 50 ul Ask for price

PSMC1 Rabbit pAb

A15712-100ul 100 ul
EUR 308

PSMC1 Rabbit pAb

A15712-200ul 200 ul
EUR 459

PSMC1 Rabbit pAb

A15712-20ul 20 ul
EUR 183

PSMC1 Rabbit pAb

A15712-50ul 50 ul
EUR 223

Psmc1 Blocking Peptide

33R-2542 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Psmc1 antibody, catalog no. 70R-9398

PSMC1 Blocking Peptide

DF12710-BP 1mg
EUR 195

PSMC1 Conjugated Antibody

C36704 100ul
EUR 397

PSMC1 cloning plasmid

CSB-CL018888HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1323
  • Sequence: atgggtcaaagtcagagtggtggtcatggtcctggaggtggcaagaaggatgacaaggacaagaaaaagaaatatgaacctcctgtaccaactagagtggggaaaaagaagaagaaaacaaagggaccagatgctgccagcaaactgccactggtgacacctcacactcagtgcc
  • Show more
Description: A cloning plasmid for the PSMC1 gene.

PSMC1 cloning plasmid

CSB-CL018888HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1323
  • Sequence: atgggtcaaagtcagagtggtggtcatggtcctggaggtggcaagaaggatgacaaggacaagaaaaagaaatatgaacctcctgtaccaactagagtggggaaaaagaagaagaaaacaaagggaccagatgctgccagcaaactgccactggtgacacctcacactcagtgcc
  • Show more
Description: A cloning plasmid for the PSMC1 gene.

PSMC1 cloning plasmid

CSB-CL018888HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1323
  • Sequence: atgggtcaaagtcagagtggtggtcatggtcctggaggtggcaagaaggatgacaaggacaagaaaaagaaatatgaacctcctgtaccaactagagtggggaaaaagaagaagaaaacaaagggaccagatgctgccagcaaactgccactggtgacacctcacactcagtgcc
  • Show more
Description: A cloning plasmid for the PSMC1 gene.

anti- PSMC1 antibody

FNab06877 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: proteasome(prosome, macropain) 26S subunit, ATPase, 1
  • Uniprot ID: P62191
  • Gene ID: 5700
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against PSMC1

Anti-PSMC1 antibody

PAab06877 100 ug
EUR 355

Anti-PSMC1 antibody

STJ111058 100 µl
EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit and a 20S core alpha subunit interact specifically with the hepatitis B virus X protein, a protein critical to viral replication. This subunit also interacts with the adenovirus E1A protein and this interaction alters the activity of the proteasome. Finally, this subunit interacts with ataxin-7, suggesting a role for the proteasome in the development of spinocerebellar ataxia type 7, a progressive neurodegenerative disorder.

Anti-PSMC1 antibody

STJ118172 100 µl
EUR 277

PSMC1 ELISA KIT|Human

EF002119 96 Tests
EUR 689

Mouse PSMC1 shRNA Plasmid

20-abx972245
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PSMC1 shRNA Plasmid

20-abx987436
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PSMC1 shRNA Plasmid

20-abx953847
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMC1 Recombinant Protein (Human)

RP024949 100 ug Ask for price

PSMC1 Recombinant Protein (Human)

RP024952 100 ug Ask for price

PSMC1 Recombinant Protein (Human)

RP024955 100 ug Ask for price

PSMC1 Recombinant Protein (Mouse)

RP165293 100 ug Ask for price

PSMC1 Recombinant Protein (Rat)

RP222635 100 ug Ask for price

Psmc1 ORF Vector (Rat) (pORF)

ORF074213 1.0 ug DNA
EUR 506

PSMC1 ORF Vector (Human) (pORF)

ORF008317 1.0 ug DNA
EUR 95

PSMC1 ORF Vector (Human) (pORF)

ORF008318 1.0 ug DNA
EUR 95

PSMC1 ORF Vector (Human) (pORF)

ORF008319 1.0 ug DNA
EUR 95

Psmc1 ORF Vector (Mouse) (pORF)

ORF055099 1.0 ug DNA
EUR 506

Polyclonal Psmc1 antibody - C-terminal region

APR01319G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Psmc1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Psmc1 sgRNA CRISPR Lentivector set (Rat)

K7082801 3 x 1.0 ug
EUR 339

Psmc1 sgRNA CRISPR Lentivector set (Mouse)

K4691501 3 x 1.0 ug
EUR 339

PSMC1 sgRNA CRISPR Lentivector set (Human)

K1740701 3 x 1.0 ug
EUR 339

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody

20-abx214050
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody

20-abx114740
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody

20-abx123801
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody

20-abx128623
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody

abx122069-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody

20-abx242173
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody

abx236877-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Psmc1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7082802 1.0 ug DNA
EUR 154