In den Nachrichten


PSMC6 antibody

70R-19595 50 ul
EUR 435.00
Description: Rabbit polyclonal PSMC6 antibody

PSMC6 antibody

70R-12798 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal PSMC6 antibody

PSMC6 Antibody

34306-100ul 100ul
EUR 252.00

PSMC6 Antibody

34306-50ul 50ul
EUR 187.00

PSMC6 Antibody

32815-100ul 100ul
EUR 252.00

PSMC6 Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

PSMC6 Antibody

DF7312 200ul
EUR 304.00
Description: PSMC6 Antibody detects endogenous levels of total PSMC6.

PSMC6 Antibody

EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PSMC6 Antibody

CSB-PA288074-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PSMC6 antibody

70R-9754 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal PSMC6 antibody

PSMC6 antibody

70R-50278 100 ul
EUR 244.00
Description: Purified Polyclonal PSMC6 antibody

PSMC6 antibody

70R-33874 100 ug
EUR 327.00
Description: Rabbit polyclonal PSMC6 antibody

PSMC6 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PSMC6 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:2000


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PSMC6 Antibody

ABD7312 100 ug
EUR 438.00


YF-PA24505 50 ul
EUR 334.00
Description: Mouse polyclonal to PSMC6

Polyclonal PSMC6 Antibody

APR05456G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMC6 . This antibody is tested and proven to work in the following applications:

PSMC6 Blocking Peptide

DF7312-BP 1mg
EUR 195.00

PSMC6 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PSMC6 Conjugated Antibody

C32815 100ul
EUR 397.00

PSMC6 cloning plasmid

CSB-CL018896HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1170
  • Sequence: atggcggaccctagagataaggcgcttcaggactaccgcaagaagttgcttgaacacaaggagatcgacggccgtcttaaggagttaagggaacaattaaaagaacttaccaagcagtatgaaaagtctgaaaatgatctgaaggccctacagagtgttgggcagatcgtgggtg
  • Show more
Description: A cloning plasmid for the PSMC6 gene.

PSMC6 Polyclonal Antibody

ABP52271-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PSMC6 from Human, Mouse. This PSMC6 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110

PSMC6 Polyclonal Antibody

ABP52271-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PSMC6 from Human, Mouse. This PSMC6 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110

PSMC6 Polyclonal Antibody

ABP52271-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PSMC6 from Human, Mouse. This PSMC6 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110

PSMC6 Polyclonal Antibody

A60454 100 µg
EUR 570.55
Description: reagents widely cited

PSMC6 Rabbit pAb

A5377-100ul 100 ul
EUR 308.00

PSMC6 Rabbit pAb

A5377-200ul 200 ul
EUR 459.00

PSMC6 Rabbit pAb

A5377-20ul 20 ul
EUR 183.00

PSMC6 Rabbit pAb

A5377-50ul 50 ul
EUR 223.00

anti- PSMC6 antibody

FNab06881 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: proteasome (prosome, macropain) 26S subunit, ATPase, 6
  • Uniprot ID: P62333
  • Gene ID: 5706
  • Research Area: Metabolism
Description: Antibody raised against PSMC6

PSMC6 Polyclonal Antibody

ES3270-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against PSMC6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PSMC6 Polyclonal Antibody

ES3270-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against PSMC6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti-PSMC6 (2C4)

LF-MA10256 100 ug
EUR 363.00
Description: Mouse monoclonal to PSMC6

Anti-PSMC6 antibody

PAab06881 100 ug
EUR 355.00

Anti-PSMC6 antibody

STJ27330 100 µl
EUR 277.00
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. Pseudogenes have been identified on chromosomes 8 and 12.

Anti-PSMC6 antibody

STJ95250 200 µl
EUR 197.00
Description: Rabbit polyclonal to PSMC6.

Anti-PSMC6 (1E5)

YF-MA20402 100 ug
EUR 363.00
Description: Mouse monoclonal to PSMC6


EF002124 96 Tests
EUR 689.00

Mouse PSMC6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

PSMC6 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMC6 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMC6 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human PSMC6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

PSMC6 Recombinant Protein (Human)

RP024970 100 ug Ask for price

PSMC6 Recombinant Protein (Mouse)

RP165311 100 ug Ask for price

PSMC6 Recombinant Protein (Rat)

RP222653 100 ug Ask for price

PSMC6 Polyclonal Antibody, Biotin Conjugated

A60455 100 µg
EUR 570.55
Description: Ask the seller for details

PSMC6 Polyclonal Antibody, FITC Conjugated

A60456 100 µg
EUR 570.55
Description: The best epigenetics products

PSMC6 Polyclonal Antibody, HRP Conjugated

A60457 100 µg
EUR 570.55
Description: kits suitable for this type of research

Psmc6 ORF Vector (Rat) (pORF)

ORF074219 1.0 ug DNA
EUR 506.00

PSMC6 ORF Vector (Human) (pORF)

ORF008324 1.0 ug DNA
EUR 95.00

Psmc6 ORF Vector (Mouse) (pORF)

ORF055105 1.0 ug DNA
EUR 506.00

Psmc6 sgRNA CRISPR Lentivector set (Rat)

K6077601 3 x 1.0 ug
EUR 339.00