PSMC6

PSMC6 antibody
70R-19595 50 ul
EUR 435
Description: Rabbit polyclonal PSMC6 antibody

PSMC6 antibody
70R-12798 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PSMC6 antibody

PSMC6 Antibody
34306-100ul 100ul
EUR 252

PSMC6 Antibody
34306-50ul 50ul
EUR 187

PSMC6 Antibody
32815-100ul 100ul
EUR 252

PSMC6 Antibody
1-CSB-PA003865
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

PSMC6 Antibody
DF7312 200ul
EUR 304
Description: PSMC6 Antibody detects endogenous levels of total PSMC6.

PSMC6 Antibody
CSB-PA288074-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PSMC6 Antibody
CSB-PA288074-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PSMC6 antibody
70R-9754 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal PSMC6 antibody

PSMC6 antibody
70R-50278 100 ul
EUR 244
Description: Purified Polyclonal PSMC6 antibody

PSMC6 antibody
70R-33874 100 ug
EUR 327
Description: Rabbit polyclonal PSMC6 antibody

PSMC6 Antibody
1-CSB-PA018896GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PSMC6 Antibody
1-CSB-PA018896LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:2000

PSMC6 siRNA
20-abx930172
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMC6 siRNA
20-abx930173
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMC6 Antibody
ABD7312 100 ug
EUR 438

anti-PSMC6
YF-PA24505 50 ul
EUR 334
Description: Mouse polyclonal to PSMC6

Polyclonal PSMC6 Antibody
APR05456G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMC6 . This antibody is tested and proven to work in the following applications:

PSMC6 Blocking Peptide
DF7312-BP 1mg
EUR 195

PSMC6 Blocking Peptide
20-abx063153
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PSMC6 Conjugated Antibody
C32815 100ul
EUR 397

PSMC6 cloning plasmid
CSB-CL018896HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1170
  • Sequence: atggcggaccctagagataaggcgcttcaggactaccgcaagaagttgcttgaacacaaggagatcgacggccgtcttaaggagttaagggaacaattaaaagaacttaccaagcagtatgaaaagtctgaaaatgatctgaaggccctacagagtgttgggcagatcgtgggtg
  • Show more
Description: A cloning plasmid for the PSMC6 gene.

PSMC6 Polyclonal Antibody
ABP52271-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PSMC6 from Human, Mouse. This PSMC6 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110

PSMC6 Polyclonal Antibody
ABP52271-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PSMC6 from Human, Mouse. This PSMC6 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110

PSMC6 Polyclonal Antibody
ABP52271-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of PSMC6 from Human, Mouse. This PSMC6 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110

PSMC6 Polyclonal Antibody
A60454 100 µg
EUR 570.55
Description: reagents widely cited

PSMC6 Rabbit pAb
A5377-100ul 100 ul
EUR 308

PSMC6 Rabbit pAb
A5377-200ul 200 ul
EUR 459

PSMC6 Rabbit pAb
A5377-20ul 20 ul
EUR 183

PSMC6 Rabbit pAb
A5377-50ul 50 ul
EUR 223

anti- PSMC6 antibody
FNab06881 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: proteasome (prosome, macropain) 26S subunit, ATPase, 6
  • Uniprot ID: P62333
  • Gene ID: 5706
  • Research Area: Metabolism
Description: Antibody raised against PSMC6

PSMC6 Polyclonal Antibody
ES3270-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PSMC6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PSMC6 Polyclonal Antibody
ES3270-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PSMC6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti-PSMC6 (2C4)
LF-MA10256 100 ug
EUR 363
Description: Mouse monoclonal to PSMC6

Anti-PSMC6 antibody
PAab06881 100 ug
EUR 355

Anti-PSMC6 antibody
STJ27330 100 µl
EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. Pseudogenes have been identified on chromosomes 8 and 12.

Anti-PSMC6 antibody
STJ95250 200 µl
EUR 197
Description: Rabbit polyclonal to PSMC6.

Anti-PSMC6 (1E5)
YF-MA20402 100 ug
EUR 363
Description: Mouse monoclonal to PSMC6

PSMC6 ELISA KIT|Human
EF002124 96 Tests
EUR 689

Mouse PSMC6 shRNA Plasmid
20-abx975963
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMC6 Antibody, HRP conjugated
1-CSB-PA018896LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMC6 Antibody, FITC conjugated
1-CSB-PA018896LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMC6 Antibody, Biotin conjugated
1-CSB-PA018896LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human PSMC6 shRNA Plasmid
20-abx953852
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMC6 Recombinant Protein (Human)
RP024970 100 ug Ask for price

PSMC6 Recombinant Protein (Mouse)
RP165311 100 ug Ask for price

PSMC6 Recombinant Protein (Rat)
RP222653 100 ug Ask for price

PSMC6 Polyclonal Antibody, Biotin Conjugated
A60455 100 µg
EUR 570.55
Description: Ask the seller for details

PSMC6 Polyclonal Antibody, FITC Conjugated
A60456 100 µg
EUR 570.55
Description: The best epigenetics products

PSMC6 Polyclonal Antibody, HRP Conjugated
A60457 100 µg
EUR 570.55
Description: kits suitable for this type of research

Psmc6 ORF Vector (Rat) (pORF)
ORF074219 1.0 ug DNA
EUR 506

PSMC6 ORF Vector (Human) (pORF)
ORF008324 1.0 ug DNA
EUR 95

Psmc6 ORF Vector (Mouse) (pORF)
ORF055105 1.0 ug DNA
EUR 506

Psmc6 sgRNA CRISPR Lentivector set (Rat)
K6077601 3 x 1.0 ug
EUR 339