PSMC6

PSMC6 antibody
70R-19595	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal PSMC6 antibody

PSMC6 antibody
70R-12798	Fitzgerald	100 ul	EUR 457.00
Description: Affinity purified Rabbit polyclonal PSMC6 antibody

PSMC6 Antibody
34306-100ul	SAB	100ul	EUR 252.00

PSMC6 Antibody
34306-50ul	SAB	50ul	EUR 187.00

PSMC6 Antibody
32815-100ul	SAB	100ul	EUR 252.00

PSMC6 Antibody
1-CSB-PA003865	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

PSMC6 Antibody
DF7312	Affbiotech	200ul	EUR 304.00
Description: PSMC6 Antibody detects endogenous levels of total PSMC6.

PSMC6 Antibody
CSB-PA288074-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PSMC6 Antibody
CSB-PA288074-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PSMC6 antibody
70R-9754	Fitzgerald	50 ug	EUR 467.00
Description: Affinity purified rabbit polyclonal PSMC6 antibody

PSMC6 antibody
70R-50278	Fitzgerald	100 ul	EUR 244.00
Description: Purified Polyclonal PSMC6 antibody

PSMC6 antibody
70R-33874	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal PSMC6 antibody

PSMC6 Antibody
1-CSB-PA018896GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PSMC6 Antibody
1-CSB-PA018896LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:2000

PSMC6 siRNA
20-abx930172	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

PSMC6 siRNA
20-abx930173	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

PSMC6 Antibody
ABD7312	Lifescience Market	100 ug	EUR 438.00

anti-PSMC6
YF-PA24505	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to PSMC6

Polyclonal PSMC6 Antibody
APR05456G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMC6 . This antibody is tested and proven to work in the following applications:

PSMC6 Blocking Peptide
DF7312-BP	Affbiotech	1mg	EUR 195.00

PSMC6 Blocking Peptide
20-abx063153	Abbexa	EUR 272.00 EUR 411.00	0 1
Shipped within 5-10 working days.

PSMC6 Conjugated Antibody
C32815	SAB	100ul	EUR 397.00

PSMC6 cloning plasmid
CSB-CL018896HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1170 Sequence: atggcggaccctagagataaggcgcttcaggactaccgcaagaagttgcttgaacacaaggagatcgacggccgtcttaaggagttaagggaacaattaaaagaacttaccaagcagtatgaaaagtctgaaaatgatctgaaggccctacagagtgttgggcagatcgtgggtg Show more
Description: A cloning plasmid for the PSMC6 gene.

PSMC6 Polyclonal Antibody
ABP52271-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110 Applications tips:
Description: A polyclonal antibody for detection of PSMC6 from Human, Mouse. This PSMC6 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110

PSMC6 Polyclonal Antibody
ABP52271-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110 Applications tips:
Description: A polyclonal antibody for detection of PSMC6 from Human, Mouse. This PSMC6 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110

PSMC6 Polyclonal Antibody
ABP52271-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110 Applications tips:
Description: A polyclonal antibody for detection of PSMC6 from Human, Mouse. This PSMC6 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PSMC6 at AA range: 30-110

PSMC6 Polyclonal Antibody
A60454	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

PSMC6 Rabbit pAb
A5377-100ul	Abclonal	100 ul	EUR 308.00

PSMC6 Rabbit pAb
A5377-200ul	Abclonal	200 ul	EUR 459.00

PSMC6 Rabbit pAb
A5377-20ul	Abclonal	20 ul	EUR 183.00

PSMC6 Rabbit pAb
A5377-50ul	Abclonal	50 ul	EUR 223.00

anti- PSMC6 antibody
FNab06881	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: proteasome (prosome, macropain) 26S subunit, ATPase, 6 Uniprot ID: P62333 Gene ID: 5706 Research Area: Metabolism
Description: Antibody raised against PSMC6

PSMC6 Polyclonal Antibody
ES3270-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against PSMC6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PSMC6 Polyclonal Antibody
ES3270-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against PSMC6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti-PSMC6 (2C4)
LF-MA10256	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to PSMC6

Anti-PSMC6 antibody
PAab06881	Lifescience Market	100 ug	EUR 355.00

Anti-PSMC6 antibody
STJ27330	St John's Laboratory	100 µl	EUR 277.00
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. Pseudogenes have been identified on chromosomes 8 and 12.

Anti-PSMC6 antibody
STJ95250	St John's Laboratory	200 µl	EUR 197.00
Description: Rabbit polyclonal to PSMC6.

Anti-PSMC6 (1E5)
YF-MA20402	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to PSMC6

PSMC6 ELISA KIT|Human
EF002124	Lifescience Market	96 Tests	EUR 689.00

Mouse PSMC6 shRNA Plasmid
20-abx975963	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

PSMC6 Antibody, HRP conjugated
1-CSB-PA018896LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMC6 Antibody, FITC conjugated
1-CSB-PA018896LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMC6 Antibody, Biotin conjugated
1-CSB-PA018896LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC6. Recognizes PSMC6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human PSMC6 shRNA Plasmid
20-abx953852	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

PSMC6 Recombinant Protein (Human)
RP024970	ABM	100 ug	Ask for price

PSMC6 Recombinant Protein (Mouse)
RP165311	ABM	100 ug	Ask for price

PSMC6 Recombinant Protein (Rat)
RP222653	ABM	100 ug	Ask for price

PSMC6 Polyclonal Antibody, Biotin Conjugated
A60455	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

PSMC6 Polyclonal Antibody, FITC Conjugated
A60456	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

PSMC6 Polyclonal Antibody, HRP Conjugated
A60457	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Psmc6 ORF Vector (Rat) (pORF)
ORF074219	ABM	1.0 ug DNA	EUR 506.00

PSMC6 ORF Vector (Human) (pORF)
ORF008324	ABM	1.0 ug DNA	EUR 95.00

Psmc6 ORF Vector (Mouse) (pORF)
ORF055105	ABM	1.0 ug DNA	EUR 506.00

Psmc6 sgRNA CRISPR Lentivector set (Rat)
K6077601	ABM	3 x 1.0 ug	EUR 339.00