PSMD8

PSMD8 Antibody

35895-100ul 100ul
EUR 252.00

PSMD8 Antibody

1-CSB-PA073605
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMD8. Recognizes PSMD8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

PSMD8 Antibody

1-CSB-PA933880
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMD8. Recognizes PSMD8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

PSMD8 Antibody

1-CSB-PA018913ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PSMD8. Recognizes PSMD8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PSMD8 siRNA

20-abx930198
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PSMD8 siRNA

20-abx930199
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

anti-PSMD8

YF-PA14138 50 ul
EUR 363.00
Description: Mouse polyclonal to PSMD8

anti-PSMD8

YF-PA14139 50 ul
EUR 363.00
Description: Mouse polyclonal to PSMD8

anti-PSMD8

YF-PA14140 50 ug
EUR 363.00
Description: Mouse polyclonal to PSMD8

PSMD8 Blocking Peptide

33R-2234 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMD8 antibody, catalog no. 70R-2345

PSMD8 Conjugated Antibody

C35895 100ul
EUR 397.00

PSMD8 cloning plasmid

CSB-CL018913HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 774
  • Sequence: atgtacgagcaactcaagggcgagtggaaccgtaaaagccccaatcttagcaagtgcggggaagagctgggtcgactcaagctagttcttctggagctcaacttcttgccaaccacagggaccaagctgaccaaacagcagctaattctggcccgtgacatactggagatcggggc
  • Show more
Description: A cloning plasmid for the PSMD8 gene.

PSMD8 Rabbit pAb

A6955-100ul 100 ul
EUR 308.00

PSMD8 Rabbit pAb

A6955-200ul 200 ul
EUR 459.00

PSMD8 Rabbit pAb

A6955-20ul 20 ul
EUR 183.00

PSMD8 Rabbit pAb

A6955-50ul 50 ul
EUR 223.00

Anti-PSMD8 antibody

STJ29035 100 µl
EUR 277.00
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 1.

Mouse Psmd8 ELISA KIT

ELI-30608m 96 Tests
EUR 865.00

Bovine PSMD8 ELISA KIT

ELI-44839b 96 Tests
EUR 928.00

Human PSMD8 ELISA KIT

ELI-44840h 96 Tests
EUR 824.00

Mouse PSMD8 shRNA Plasmid

20-abx974970
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human PSMD8 shRNA Plasmid

20-abx953859
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

PSMD8 Recombinant Protein (Human)

RP025015 100 ug Ask for price

PSMD8 Recombinant Protein (Mouse)

RP165353 100 ug Ask for price

PSMD8 Recombinant Protein (Rat)

RP222692 100 ug Ask for price

Psmd8 ORF Vector (Rat) (pORF)

ORF074232 1.0 ug DNA
EUR 506.00

PSMD8 ORF Vector (Human) (pORF)

ORF008339 1.0 ug DNA
EUR 95.00

Psmd8 ORF Vector (Mouse) (pORF)

ORF055119 1.0 ug DNA
EUR 506.00

pCMV-SPORT6-PSMD8(210-1053bp)

PVT14339 2 ug
EUR 495.00

Polyclonal PSMD8 antibody - C-terminal region

APR01031G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMD8 - C-terminal region. This antibody is tested and proven to work in the following applications:

Psmd8 sgRNA CRISPR Lentivector set (Rat)

K6408901 3 x 1.0 ug
EUR 339.00

Psmd8 sgRNA CRISPR Lentivector set (Mouse)

K3479501 3 x 1.0 ug
EUR 339.00

PSMD8 sgRNA CRISPR Lentivector set (Human)

K1742801 3 x 1.0 ug
EUR 339.00

Psmd8 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6408902 1.0 ug DNA
EUR 154.00

Psmd8 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6408903 1.0 ug DNA
EUR 154.00

Psmd8 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6408904 1.0 ug DNA
EUR 154.00

Psmd8 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3479502 1.0 ug DNA
EUR 154.00

Psmd8 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3479503 1.0 ug DNA
EUR 154.00

Psmd8 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3479504 1.0 ug DNA
EUR 154.00

PSMD8 sgRNA CRISPR Lentivector (Human) (Target 1)

K1742802 1.0 ug DNA
EUR 154.00

PSMD8 sgRNA CRISPR Lentivector (Human) (Target 2)

K1742803 1.0 ug DNA
EUR 154.00

PSMD8 sgRNA CRISPR Lentivector (Human) (Target 3)

K1742804 1.0 ug DNA
EUR 154.00

PSMD8 Protein Vector (Rat) (pPB-C-His)

PV296926 500 ng
EUR 603.00

PSMD8 Protein Vector (Rat) (pPB-N-His)

PV296927 500 ng
EUR 603.00

PSMD8 Protein Vector (Rat) (pPM-C-HA)

PV296928 500 ng
EUR 603.00

PSMD8 Protein Vector (Rat) (pPM-C-His)

PV296929 500 ng
EUR 603.00

PSMD8 Protein Vector (Human) (pPB-C-His)

PV033353 500 ng
EUR 329.00

PSMD8 Protein Vector (Human) (pPB-N-His)

PV033354 500 ng
EUR 329.00

PSMD8 Protein Vector (Human) (pPM-C-HA)

PV033355 500 ng
EUR 329.00

PSMD8 Protein Vector (Human) (pPM-C-His)

PV033356 500 ng
EUR 329.00

PSMD8 Protein Vector (Mouse) (pPB-C-His)

PV220474 500 ng
EUR 603.00

PSMD8 Protein Vector (Mouse) (pPB-N-His)

PV220475 500 ng
EUR 603.00

PSMD8 Protein Vector (Mouse) (pPM-C-HA)

PV220476 500 ng
EUR 603.00

PSMD8 Protein Vector (Mouse) (pPM-C-His)

PV220477 500 ng
EUR 603.00

Psmd8 3'UTR Luciferase Stable Cell Line

TU117194 1.0 ml Ask for price