PSME4

PSME4 siRNA
20-abx930209
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSME4 antibody
70R-19610 50 ul
EUR 435
Description: Rabbit polyclonal PSME4 antibody

PSME4 Antibody
1-CSB-PA618917LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSME4. Recognizes PSME4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000

PSME4 Antibody
1-CSB-PA018919GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSME4. Recognizes PSME4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PSME4 cloning plasmid
CSB-CL618917HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgtctcaggggttgctttaccctcatcaagtgcctttggtacttcaggtgctaaaacaaacagcaagaagcagttcttggcatgcacgatacacagtactgacctacctccagaccatggtattttataacctctttattttcctaaacaatgaagatgcagttaaagatatcag
  • Show more
Description: A cloning plasmid for the PSME4 gene.

PSME4 cloning plasmid
CSB-CL618917HU2-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 5190
  • Sequence: atgatgcagggatttgcccgccttttgatcaacttgttaaagaaaaaggaacttctttcaagagctgatttggagttaccctggagaccactttatgacatggtagaaagaatattatattccaagacagagcacctaggattaaattggtttcctaattctgtagaaaatattc
  • Show more
Description: A cloning plasmid for the PSME4 gene.

anti- PSME4 antibody
FNab06897 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:10-1:100
  • Immunogen: proteasome(prosome, macropain) activator subunit 4
  • Uniprot ID: Q14997
  • Gene ID: 23198
  • Research Area: Developmental biology
Description: Antibody raised against PSME4

PSME4 Rabbit pAb
A13815-100ul 100 ul
EUR 308

PSME4 Rabbit pAb
A13815-200ul 200 ul
EUR 459

PSME4 Rabbit pAb
A13815-20ul 20 ul
EUR 183

PSME4 Rabbit pAb
A13815-50ul 50 ul
EUR 223

PSME4 Polyclonal Antibody
28361-100ul 100ul
EUR 252

PSME4 Polyclonal Antibody
28361-50ul 50ul
EUR 187

Anti-PSME4 antibody
PAab06897 100 ug
EUR 355

Anti-PSME4 antibody
STJ11100749 100 µl
EUR 413

Anti-PSME4 antibody
STJ115757 100 µl
EUR 277

PSME4 Polyclonal Conjugated Antibody
C28361 100ul
EUR 397

Mouse PSME4 shRNA Plasmid
20-abx979583
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSME4 ELISA KIT|Human
EF002140 96 Tests
EUR 689

Human PSME4 shRNA Plasmid
20-abx958078
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSME4 Antibody, HRP conjugated
1-CSB-PA618917LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSME4. Recognizes PSME4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSME4 Antibody, FITC conjugated
1-CSB-PA618917LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSME4. Recognizes PSME4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSME4 Antibody, Biotin conjugated
1-CSB-PA618917LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSME4. Recognizes PSME4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal PSME4 Antibody (N-Term)
APR04975G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSME4 (N-Term). This antibody is tested and proven to work in the following applications:

[KO Validated] PSME4 Rabbit pAb
A19873-100ul 100 ul
EUR 410

[KO Validated] PSME4 Rabbit pAb
A19873-200ul 200 ul
EUR 571

[KO Validated] PSME4 Rabbit pAb
A19873-20ul 20 ul
EUR 221

[KO Validated] PSME4 Rabbit pAb
A19873-50ul 50 ul
EUR 287

PSME4 ORF Vector (Human) (pORF)
ORF008345 1.0 ug DNA
EUR 95

Psme4 ORF Vector (Rat) (pORF)
ORF074237 1.0 ug DNA
EUR 2080

PSME4 ORF Vector (Human) (pORF)
ORF014191 1.0 ug DNA
EUR 354

Psme4 ORF Vector (Mouse) (pORF)
ORF055125 1.0 ug DNA
EUR 1572

Proteasome Activator Subunit 4 (PSME4) Antibody
abx236897-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

PSME4 sgRNA CRISPR Lentivector set (Human)
K1745001 3 x 1.0 ug
EUR 339

Psme4 sgRNA CRISPR Lentivector set (Mouse)
K4083801 3 x 1.0 ug
EUR 339

Psme4 sgRNA CRISPR Lentivector set (Rat)
K6083301 3 x 1.0 ug
EUR 339

PSME4 sgRNA CRISPR Lentivector (Human) (Target 1)
K1745002 1.0 ug DNA
EUR 154

PSME4 sgRNA CRISPR Lentivector (Human) (Target 2)
K1745003 1.0 ug DNA
EUR 154

PSME4 sgRNA CRISPR Lentivector (Human) (Target 3)
K1745004 1.0 ug DNA
EUR 154

Psme4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4083802 1.0 ug DNA
EUR 154

Psme4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4083803 1.0 ug DNA
EUR 154

Psme4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4083804 1.0 ug DNA
EUR 154

Psme4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6083302 1.0 ug DNA
EUR 154

Psme4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6083303 1.0 ug DNA
EUR 154

Psme4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6083304 1.0 ug DNA
EUR 154

PSME4 Protein Vector (Human) (pPB-C-His)
PV056761 500 ng
EUR 481

PSME4 Protein Vector (Human) (pPB-N-His)
PV056762 500 ng
EUR 481

PSME4 Protein Vector (Human) (pPM-C-HA)
PV056763 500 ng
EUR 481

PSME4 Protein Vector (Human) (pPM-C-His)
PV056764 500 ng
EUR 481

PSME4 Protein Vector (Human) (pPB-C-His)
PV033377 500 ng
EUR 329

PSME4 Protein Vector (Human) (pPB-N-His)
PV033378 500 ng
EUR 329

PSME4 Protein Vector (Human) (pPM-C-HA)
PV033379 500 ng
EUR 329

PSME4 Protein Vector (Human) (pPM-C-His)
PV033380 500 ng
EUR 329

PSME4 Protein Vector (Rat) (pPB-C-His)
PV296946 500 ng
EUR 3060

PSME4 Protein Vector (Rat) (pPB-N-His)
PV296947 500 ng
EUR 3060