PSME4 Antibody
1-CSB-PA618917LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSME4. Recognizes PSME4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000

PSME4 Antibody
1-CSB-PA018919GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSME4. Recognizes PSME4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PSME4 siRNA
20-abx930208	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

PSME4 siRNA
20-abx930209	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

PSME4 Polyclonal Antibody
28361-100ul	SAB	100ul	EUR 252.00

PSME4 Polyclonal Antibody
28361-50ul	SAB	50ul	EUR 187.00

PSME4 Rabbit pAb
A13815-100ul	Abclonal	100 ul	EUR 308.00

PSME4 Rabbit pAb
A13815-200ul	Abclonal	200 ul	EUR 459.00

PSME4 Rabbit pAb
A13815-20ul	Abclonal	20 ul	EUR 183.00

PSME4 Rabbit pAb
A13815-50ul	Abclonal	50 ul	EUR 223.00

PSME4 cloning plasmid
CSB-CL618917HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 648 Sequence: atgtctcaggggttgctttaccctcatcaagtgcctttggtacttcaggtgctaaaacaaacagcaagaagcagttcttggcatgcacgatacacagtactgacctacctccagaccatggtattttataacctctttattttcctaaacaatgaagatgcagttaaagatatcag Show more
Description: A cloning plasmid for the PSME4 gene.

PSME4 cloning plasmid
CSB-CL618917HU2-10ug	Cusabio	10ug	EUR 2770.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 5190 Sequence: atgatgcagggatttgcccgccttttgatcaacttgttaaagaaaaaggaacttctttcaagagctgatttggagttaccctggagaccactttatgacatggtagaaagaatattatattccaagacagagcacctaggattaaattggtttcctaattctgtagaaaatattc Show more
Description: A cloning plasmid for the PSME4 gene.

anti- PSME4 antibody
FNab06897	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IP: 1:500-1:1000 IHC: 1:50-1:500 IF: 1:10-1:100 Immunogen: proteasome(prosome, macropain) activator subunit 4 Uniprot ID: Q14997 Gene ID: 23198 Research Area: Developmental biology
Description: Antibody raised against PSME4

Anti-PSME4 antibody
PAab06897	Lifescience Market	100 ug	EUR 355.00

Anti-PSME4 antibody
STJ11100749	St John's Laboratory	100 µl	EUR 413.00

Anti-PSME4 antibody
STJ115757	St John's Laboratory	100 µl	EUR 277.00

PSME4 Antibody, HRP conjugated
1-CSB-PA618917LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSME4. Recognizes PSME4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSME4 Antibody, FITC conjugated
1-CSB-PA618917LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSME4. Recognizes PSME4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSME4 Antibody, Biotin conjugated
1-CSB-PA618917LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSME4. Recognizes PSME4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PSME4 ELISA KIT|Human
EF002140	Lifescience Market	96 Tests	EUR 689.00

PSME4 Polyclonal Conjugated Antibody
C28361	SAB	100ul	EUR 397.00

Human PSME4 shRNA Plasmid
20-abx958078	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse PSME4 shRNA Plasmid
20-abx979583	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Polyclonal PSME4 Antibody (N-Term)
APR04975G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSME4 (N-Term). This antibody is tested and proven to work in the following applications:

[KO Validated] PSME4 Rabbit pAb
A19873-100ul	Abclonal	100 ul	EUR 410.00

[KO Validated] PSME4 Rabbit pAb
A19873-200ul	Abclonal	200 ul	EUR 571.00

[KO Validated] PSME4 Rabbit pAb
A19873-20ul	Abclonal	20 ul	EUR 221.00

[KO Validated] PSME4 Rabbit pAb
A19873-50ul	Abclonal	50 ul	EUR 287.00

Psme4 ORF Vector (Rat) (pORF)
ORF074237	ABM	1.0 ug DNA	EUR 2080.00

PSME4 ORF Vector (Human) (pORF)
ORF014191	ABM	1.0 ug DNA	EUR 354.00

PSME4 ORF Vector (Human) (pORF)
ORF008345	ABM	1.0 ug DNA	EUR 95.00

Psme4 ORF Vector (Mouse) (pORF)
ORF055125	ABM	1.0 ug DNA	EUR 1572.00

Proteasome Activator Subunit 4 (PSME4) Antibody
abx236897-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Psme4 sgRNA CRISPR Lentivector set (Rat)
K6083301	ABM	3 x 1.0 ug	EUR 339.00

Psme4 sgRNA CRISPR Lentivector set (Mouse)
K4083801	ABM	3 x 1.0 ug	EUR 339.00

PSME4 sgRNA CRISPR Lentivector set (Human)
K1745001	ABM	3 x 1.0 ug	EUR 339.00

Psme4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6083302	ABM	1.0 ug DNA	EUR 154.00

Psme4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6083303	ABM	1.0 ug DNA	EUR 154.00

Psme4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6083304	ABM	1.0 ug DNA	EUR 154.00

Psme4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4083802	ABM	1.0 ug DNA	EUR 154.00

Psme4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4083803	ABM	1.0 ug DNA	EUR 154.00

Psme4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4083804	ABM	1.0 ug DNA	EUR 154.00

PSME4 sgRNA CRISPR Lentivector (Human) (Target 1)
K1745002	ABM	1.0 ug DNA	EUR 154.00

PSME4 sgRNA CRISPR Lentivector (Human) (Target 2)
K1745003	ABM	1.0 ug DNA	EUR 154.00

PSME4 sgRNA CRISPR Lentivector (Human) (Target 3)
K1745004	ABM	1.0 ug DNA	EUR 154.00

PSME4 Protein Vector (Rat) (pPB-C-His)
PV296946	ABM	500 ng	EUR 3060.00

PSME4 Protein Vector (Rat) (pPB-N-His)
PV296947	ABM	500 ng	EUR 3060.00

PSME4 Protein Vector (Rat) (pPM-C-HA)
PV296948	ABM	500 ng	EUR 3060.00

PSME4 Protein Vector (Rat) (pPM-C-His)
PV296949	ABM	500 ng	EUR 3060.00

PSME4 Protein Vector (Human) (pPB-C-His)
PV033377	ABM	500 ng	EUR 329.00

PSME4 Protein Vector (Human) (pPB-N-His)
PV033378	ABM	500 ng	EUR 329.00

PSME4 Protein Vector (Human) (pPM-C-HA)
PV033379	ABM	500 ng	EUR 329.00

PSME4 Protein Vector (Human) (pPM-C-His)
PV033380	ABM	500 ng	EUR 329.00

PSME4 Protein Vector (Human) (pPB-C-His)
PV056761	ABM	500 ng	EUR 481.00

PSME4 Protein Vector (Human) (pPB-N-His)
PV056762	ABM	500 ng	EUR 481.00