  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PSME4 antibody

70R-19610 50 ul
EUR 435.00
Description: Rabbit polyclonal PSME4 antibody

PSME4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSME4. Recognizes PSME4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000

PSME4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSME4. Recognizes PSME4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PSME4 cloning plasmid

CSB-CL618917HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgtctcaggggttgctttaccctcatcaagtgcctttggtacttcaggtgctaaaacaaacagcaagaagcagttcttggcatgcacgatacacagtactgacctacctccagaccatggtattttataacctctttattttcctaaacaatgaagatgcagttaaagatatcag
  • Show more
Description: A cloning plasmid for the PSME4 gene.

PSME4 cloning plasmid

CSB-CL618917HU2-10ug 10ug
EUR 2770.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 5190
  • Sequence: atgatgcagggatttgcccgccttttgatcaacttgttaaagaaaaaggaacttctttcaagagctgatttggagttaccctggagaccactttatgacatggtagaaagaatattatattccaagacagagcacctaggattaaattggtttcctaattctgtagaaaatattc
  • Show more
Description: A cloning plasmid for the PSME4 gene.

anti- PSME4 antibody

FNab06897 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:10-1:100
  • Immunogen: proteasome(prosome, macropain) activator subunit 4
  • Uniprot ID: Q14997
  • Gene ID: 23198
  • Research Area: Developmental biology
Description: Antibody raised against PSME4

PSME4 Rabbit pAb

A13815-100ul 100 ul
EUR 308.00

PSME4 Rabbit pAb

A13815-200ul 200 ul
EUR 459.00

PSME4 Rabbit pAb

A13815-20ul 20 ul
EUR 183.00

PSME4 Rabbit pAb

A13815-50ul 50 ul
EUR 223.00

PSME4 Polyclonal Antibody

28361-100ul 100ul
EUR 252.00

PSME4 Polyclonal Antibody

28361-50ul 50ul
EUR 187.00

Anti-PSME4 antibody

PAab06897 100 ug
EUR 355.00

Anti-PSME4 antibody

STJ11100749 100 µl
EUR 413.00

Anti-PSME4 antibody

STJ115757 100 µl
EUR 277.00

PSME4 Polyclonal Conjugated Antibody

C28361 100ul
EUR 397.00

Mouse PSME4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.


EF002140 96 Tests
EUR 689.00

Human PSME4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

PSME4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSME4. Recognizes PSME4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSME4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSME4. Recognizes PSME4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSME4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSME4. Recognizes PSME4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal PSME4 Antibody (N-Term)

APR04975G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSME4 (N-Term). This antibody is tested and proven to work in the following applications:

[KO Validated] PSME4 Rabbit pAb

A19873-100ul 100 ul
EUR 410.00

[KO Validated] PSME4 Rabbit pAb

A19873-200ul 200 ul
EUR 571.00

[KO Validated] PSME4 Rabbit pAb

A19873-20ul 20 ul
EUR 221.00

[KO Validated] PSME4 Rabbit pAb

A19873-50ul 50 ul
EUR 287.00

PSME4 ORF Vector (Human) (pORF)

ORF008345 1.0 ug DNA
EUR 95.00

Psme4 ORF Vector (Rat) (pORF)

ORF074237 1.0 ug DNA
EUR 2080.00

PSME4 ORF Vector (Human) (pORF)

ORF014191 1.0 ug DNA
EUR 354.00

Psme4 ORF Vector (Mouse) (pORF)

ORF055125 1.0 ug DNA
EUR 1572.00

Proteasome Activator Subunit 4 (PSME4) Antibody

abx236897-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

PSME4 sgRNA CRISPR Lentivector set (Human)

K1745001 3 x 1.0 ug
EUR 339.00

Psme4 sgRNA CRISPR Lentivector set (Mouse)

K4083801 3 x 1.0 ug
EUR 339.00

Psme4 sgRNA CRISPR Lentivector set (Rat)

K6083301 3 x 1.0 ug
EUR 339.00

PSME4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1745002 1.0 ug DNA
EUR 154.00

PSME4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1745003 1.0 ug DNA
EUR 154.00

PSME4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1745004 1.0 ug DNA
EUR 154.00

Psme4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4083802 1.0 ug DNA
EUR 154.00

Psme4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4083803 1.0 ug DNA
EUR 154.00

Psme4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4083804 1.0 ug DNA
EUR 154.00

Psme4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6083302 1.0 ug DNA
EUR 154.00

Psme4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6083303 1.0 ug DNA
EUR 154.00

Psme4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6083304 1.0 ug DNA
EUR 154.00

PSME4 Protein Vector (Human) (pPB-C-His)

PV056761 500 ng
EUR 481.00

PSME4 Protein Vector (Human) (pPB-N-His)

PV056762 500 ng
EUR 481.00

PSME4 Protein Vector (Human) (pPM-C-HA)

PV056763 500 ng
EUR 481.00

PSME4 Protein Vector (Human) (pPM-C-His)

PV056764 500 ng
EUR 481.00

PSME4 Protein Vector (Human) (pPB-C-His)

PV033377 500 ng
EUR 329.00

PSME4 Protein Vector (Human) (pPB-N-His)

PV033378 500 ng
EUR 329.00

PSME4 Protein Vector (Human) (pPM-C-HA)

PV033379 500 ng
EUR 329.00

PSME4 Protein Vector (Human) (pPM-C-His)

PV033380 500 ng
EUR 329.00

PSME4 Protein Vector (Rat) (pPB-C-His)

PV296946 500 ng
EUR 3060.00

PSME4 Protein Vector (Rat) (pPB-N-His)

PV296947 500 ng
EUR 3060.00