In den Nachrichten

RAB13

RAB13 siRNA

20-abx904411
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB13 Antibody

ABD9813 100 ug
EUR 438.00

RAB13 siRNA

20-abx930599
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB13 siRNA

20-abx930600
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB13 Antibody

46176-100ul 100ul
EUR 252.00

RAB13 Antibody

46176-50ul 50ul
EUR 187.00

RAB13 Antibody

DF9813 200ul
EUR 304.00
Description: RAB13 Antibody detects endogenous levels of total RAB13.

anti-RAB13

YF-PA14261 100 ug
EUR 403.00
Description: Rabbit polyclonal to RAB13

RAB13 Conjugated Antibody

C46176 100ul
EUR 397.00

RAB13 cloning plasmid

CSB-CL019161HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 612
  • Sequence: atggccaaagcctacgaccacctcttcaagttgctgctgatcggggactcgggggtgggcaagacttgtctgatcattcgctttgcagaggacaacttcaacaacacttacatctccaccatcggaattgatttcaagatccgcactgtggatatagaggggaagaagatcaaact
  • Show more
Description: A cloning plasmid for the RAB13 gene.

RAB13 Polyclonal Antibody

ES10111-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against RAB13 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB13 Polyclonal Antibody

ES10111-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against RAB13 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB13 Polyclonal Antibody

ABP60056-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB13 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of RAB13 from Human, Mouse, Rat. This RAB13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB13 protein at amino acid sequence of 40-120

RAB13 Polyclonal Antibody

ABP60056-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB13 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of RAB13 from Human, Mouse, Rat. This RAB13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB13 protein at amino acid sequence of 40-120

RAB13 Polyclonal Antibody

ABP60056-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB13 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of RAB13 from Human, Mouse, Rat. This RAB13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB13 protein at amino acid sequence of 40-120

RAB13 Rabbit pAb

A10571-100ul 100 ul
EUR 308.00

RAB13 Rabbit pAb

A10571-200ul 200 ul
EUR 459.00

RAB13 Rabbit pAb

A10571-20ul 20 ul
EUR 183.00

RAB13 Rabbit pAb

A10571-50ul 50 ul
EUR 223.00

RAB13 Blocking Peptide

DF9813-BP 1mg
EUR 195.00

Anti-RAB13 Antibody

PB9790 100ug/vial
EUR 334.00

pCMV-SPORT6-RAB13

PVT12399 2 ug
EUR 391.00

Anti-RAB13 antibody

STJ112586 100 µl
EUR 277.00
Description: This gene is a member of the Rab family of small G proteins and plays a role in regulating membrane trafficking between trans-Golgi network (TGN) and recycling endosomes (RE). The encoded protein is involved in the assembly of tight junctions, which are components of the apical junctional complex (AJC) of epithelial cells. The AJC plays a role in forming a barrier between luminal contents and the underlying tissue. Additional functions associated with the protein include endocytic recycling of occludin, regulation of epithelial cell scattering, neuronal regeneration and regulation of neurite outgrowth. Alternately spliced transcript variants have been observed for this gene. A pseudogene associated with this gene is located on chromosome 12.

Anti-RAB13 antibody

STJ191269 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to RAB13

Anti-RAB13 (8H8)

YF-MA20408 100 ug
EUR 363.00
Description: Mouse monoclonal to RAB13

Mouse RAB13 shRNA Plasmid

20-abx976584
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat RAB13 shRNA Plasmid

20-abx986690
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human RAB13 shRNA Plasmid

20-abx953962
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RAB13 protein (His tag)

80R-1883 50 ug
EUR 397.00
Description: Purified recombinant RAB13 protein

RAB13 Recombinant Protein (Human)

RP025414 100 ug Ask for price

RAB13 Recombinant Protein (Rat)

RP223247 100 ug Ask for price

pECMV-3-FLAG-RAB13

PVT12985 2 ug
EUR 703.00

RAB13 Recombinant Protein (Mouse)

RP166193 100 ug Ask for price

Monoclonal RAB13 Antibody, Clone: 1600CT845.37.29

AMM07431G 0.1ml
EUR 484.00
Description: A Monoclonal antibody against Human RAB13. The antibodies are raised in Mouse and are from clone 1600CT845.37.29. This antibody is applicable in WB, E

Monoclonal Rab13 Antibody, Clone: 7G8A4

AMM07432G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human Rab13. The antibodies are raised in Mouse and are from clone 7G8A4. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal Rab13 Antibody, Clone: 8E8E2

AMM07433G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human Rab13. The antibodies are raised in Mouse and are from clone 8E8E2. This antibody is applicable in WB and IHC, FC, ICC, E

Polyclonal Rab13 antibody - middle region

AMM07434G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rab13 - middle region. This antibody is tested and proven to work in the following applications:

RAB13 ORF Vector (Human) (pORF)

ORF008472 1.0 ug DNA
EUR 95.00

Rab13 ORF Vector (Rat) (pORF)

ORF074417 1.0 ug DNA
EUR 506.00

Rab13 ORF Vector (Mouse) (pORF)

ORF055399 1.0 ug DNA
EUR 506.00

RAB13, Member RAS Oncogene Family Protein

20-abx262907
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

RAB13 sgRNA CRISPR Lentivector set (Human)

K1771701 3 x 1.0 ug
EUR 339.00

Rab13 sgRNA CRISPR Lentivector set (Mouse)

K4553401 3 x 1.0 ug
EUR 339.00

Rab13 sgRNA CRISPR Lentivector set (Rat)

K7011101 3 x 1.0 ug
EUR 339.00

Ras-Related Protein Rab-13 (RAB13) Antibody

20-abx126442
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-13 (RAB13) Antibody

abx122434-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-13 (Rab13) Antibody

abx016168-100ug 100 ug
EUR 411.00
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-13 (RAB13) Antibody

20-abx218107
  • EUR 425.00
  • EUR 342.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-13 (Rab13) Antibody

abx224182-100ug 100 ug
EUR 411.00
  • Shipped within 5-10 working days.

Recombinant Human RAB13, Member RAS Oncogene Family

7-06013 2µg Ask for price

Recombinant Human RAB13, Member RAS Oncogene Family

7-06014 10µg Ask for price

Recombinant Human RAB13, Member RAS Oncogene Family

7-06015 1mg Ask for price

RAB13 sgRNA CRISPR Lentivector (Human) (Target 1)

K1771702 1.0 ug DNA
EUR 154.00

RAB13 sgRNA CRISPR Lentivector (Human) (Target 2)

K1771703 1.0 ug DNA
EUR 154.00

RAB13 sgRNA CRISPR Lentivector (Human) (Target 3)

K1771704 1.0 ug DNA
EUR 154.00

Rab13 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4553402 1.0 ug DNA
EUR 154.00

Rab13 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4553403 1.0 ug DNA
EUR 154.00

Rab13 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4553404 1.0 ug DNA
EUR 154.00

Rab13 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7011102 1.0 ug DNA
EUR 154.00

Rab13 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7011103 1.0 ug DNA
EUR 154.00

Rab13 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7011104 1.0 ug DNA
EUR 154.00

Recombinant Human RAB13 Protein, His, E.coli-10ug

QP13229-10ug 10ug
EUR 201.00

Recombinant Human RAB13 Protein, His, E.coli-1mg

QP13229-1mg 1mg
EUR 5251.00

Recombinant Human RAB13 Protein, His, E.coli-2ug

QP13229-2ug 2ug
EUR 155.00

RAB13 Protein Vector (Human) (pPB-C-His)

PV033885 500 ng
EUR 329.00

RAB13 Protein Vector (Human) (pPB-N-His)

PV033886 500 ng
EUR 329.00

RAB13 Protein Vector (Human) (pPM-C-HA)

PV033887 500 ng
EUR 329.00

RAB13 Protein Vector (Human) (pPM-C-His)

PV033888 500 ng
EUR 329.00

RAB13 Protein Vector (Rat) (pPB-C-His)

PV297666 500 ng
EUR 603.00

RAB13 Protein Vector (Rat) (pPB-N-His)

PV297667 500 ng
EUR 603.00

RAB13 Protein Vector (Rat) (pPM-C-HA)

PV297668 500 ng
EUR 603.00

RAB13 Protein Vector (Rat) (pPM-C-His)

PV297669 500 ng
EUR 603.00

RAB13 Protein Vector (Mouse) (pPB-C-His)

PV221594 500 ng
EUR 603.00

RAB13 Protein Vector (Mouse) (pPB-N-His)

PV221595 500 ng
EUR 603.00

RAB13 Protein Vector (Mouse) (pPM-C-HA)

PV221596 500 ng
EUR 603.00

RAB13 Protein Vector (Mouse) (pPM-C-His)

PV221597 500 ng
EUR 603.00

Rab13 3'UTR GFP Stable Cell Line

TU167390 1.0 ml Ask for price

RAB13 3'UTR Luciferase Stable Cell Line

TU019367 1.0 ml
EUR 1394.00

Rab13 3'UTR Luciferase Stable Cell Line

TU117390 1.0 ml Ask for price

RAB13 3'UTR GFP Stable Cell Line

TU069367 1.0 ml
EUR 1394.00

Rab13 3'UTR GFP Stable Cell Line

TU267175 1.0 ml Ask for price

Rab13 3'UTR Luciferase Stable Cell Line

TU217175 1.0 ml Ask for price

RAB13 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV691807 1.0 ug DNA
EUR 514.00

RAB13 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV691811 1.0 ug DNA
EUR 514.00

RAB13 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV691812 1.0 ug DNA
EUR 514.00