RAB14

RAB14 siRNA

20-abx904412
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB14 siRNA

20-abx930601
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB14 siRNA

20-abx930602
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB14 antibody

70R-51381 100 ul
EUR 244.00
Description: Purified Polyclonal RAB14 antibody

RAB14 Antibody

37854-100ul 100ul
EUR 252.00

RAB14 antibody

70R-19686 50 ul
EUR 435.00
Description: Rabbit polyclonal RAB14 antibody

RAB14 antibody

70R-10565 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal RAB14 antibody

RAB14 Antibody

DF12460 200ul
EUR 304.00
Description: RAB14 antibody detects endogenous levels of RAB14.

RAB14 Antibody

1-CSB-PA793696
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB14. Recognizes RAB14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:300

RAB14 Antibody

1-CSB-PA019162GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAB14. Recognizes RAB14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RAB14 Conjugated Antibody

C37854 100ul
EUR 397.00

RAB14 cloning plasmid

CSB-CL019162HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atggcaactgcaccatacaactactcttacatctttaaatatattattattggggacatgggagtaggaaaatcttgcttgcttcatcaatttacagaaaaaaaatttatggctgattgtcctcacacaattggtgttgaatttggtacaagaataatcgaagttagtggccaaaa
  • Show more
Description: A cloning plasmid for the RAB14 gene.

RAB14 Polyclonal Antibody

ES11931-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against RAB14 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB14 Polyclonal Antibody

ES11931-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against RAB14 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- RAB14 antibody

FNab06996 100µg
EUR 505.25
  • Immunogen: RAB14, member RAS oncogene family
  • Uniprot ID: P61106
  • Gene ID: 51552
  • Research Area: Signal Transduction
Description: Antibody raised against RAB14

RAB14 Blocking Peptide

20-abx064256
  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB14 Polyclonal Antibody

ABP60057-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB14 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RAB14 from Human, Mouse, Rat. This RAB14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB14 protein

RAB14 Polyclonal Antibody

ABP60057-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB14 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RAB14 from Human, Mouse, Rat. This RAB14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB14 protein

RAB14 Polyclonal Antibody

ABP60057-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB14 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RAB14 from Human, Mouse, Rat. This RAB14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB14 protein

RAB14 Rabbit pAb

A12752-100ul 100 ul
EUR 308.00

RAB14 Rabbit pAb

A12752-200ul 200 ul
EUR 459.00

RAB14 Rabbit pAb

A12752-20ul 20 ul
EUR 183.00

RAB14 Rabbit pAb

A12752-50ul 50 ul
EUR 223.00

RAB14 Blocking Peptide

33R-2956 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB14 antibody, catalog no. 70R-10565

RAB14 Blocking Peptide

DF12460-BP 1mg
EUR 195.00

Anti-RAB14 Antibody

PB9815 100ug/vial
EUR 294.00

Anti-RAB14 antibody

PAab06996 100 ug
EUR 355.00

Anti-RAB14 antibody

STJ114625 100 µl
EUR 277.00

Anti-Rab14 antibody

STJ140070 100 µg
EUR 219.00
Description: RAB14 belongs to the large RAB family of low molecular weight GTPases that are involved in intracellular membrane trafficking. This protein is expressed at high levels in kidney, lung, brain, spleen and thymus and it is thought to be involved in vesicular trafficking and neurotransmitter release. It is also involved in the biosynthetic/recycling pathway between the Golgi and endosomal compartments.

Anti-Rab14 antibody

STJ140071 100 µg
EUR 219.00
Description: RAB14 belongs to the large RAB family of low molecular weight GTPases that are involved in intracellular membrane trafficking. This protein is expressed at high levels in kidney, lung, brain, spleen and thymus and it is thought to be involved in vesicular trafficking and neurotransmitter release. It is also involved in the biosynthetic/recycling pathway between the Golgi and endosomal compartments.

Anti-RAB14 antibody

STJ193089 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to RAB14

Mouse RAB14 shRNA Plasmid

20-abx976596
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat RAB14 shRNA Plasmid

20-abx987085
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human RAB14 ELISA Kit

ELA-E14990h 96 Tests
EUR 824.00

RAB14 ELISA KIT|Human

EF005847 96 Tests
EUR 689.00

Human RAB14 shRNA Plasmid

20-abx959827
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RAB14 protein (His tag)

80R-1866 50 ug
EUR 305.00
Description: Purified recombinant RAB14 protein

RAB14 Recombinant Protein (Human)

RP025417 100 ug Ask for price

RAB14 Recombinant Protein (Rat)

RP223250 100 ug Ask for price

RAB14 Recombinant Protein (Mouse)

RP166196 100 ug Ask for price

Monoclonal RAB14 Antibody, Clone: 1779CT692.32.86

AMM07435G 0.1ml
EUR 484.00
Description: A Monoclonal antibody against Human RAB14. The antibodies are raised in Mouse and are from clone 1779CT692.32.86. This antibody is applicable in WB, E

RAB14 ORF Vector (Human) (pORF)

ORF008473 1.0 ug DNA
EUR 95.00

Rab14 ORF Vector (Rat) (pORF)

ORF074418 1.0 ug DNA
EUR 506.00

Rab14 ORF Vector (Mouse) (pORF)

ORF055400 1.0 ug DNA
EUR 506.00

RAB14 Western Blot kit (AWBK13107)

AWBK13107 10 reactions
EUR 647.00
Description:
  • Description of target:
  • Species reactivity:
  • Application:
  • Assay info:
  • Sensitivity:

RAB14 ELISA Kit (Human) (OKEH02419)

OKEH02419 96 Wells
EUR 779.00
Description: Description of target: RAB14 belongs to the large RAB family of low molecular mass GTPases that are involved in intracellular membrane trafficking. These proteins act as molecular switches that flip between an inactive GDP-bound state and an active GTP-bound state in which they recruit downstream effector proteins onto membranes (Junutula et al., 2004 [PubMed 15004230]).[supplied by OMIM, Mar 2009];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.18 ng/mL

RAB14 ELISA Kit (Chicken) (OKEH08089)

OKEH08089 96 Wells
EUR 1184.00
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

RAB14 ELISA Kit (Pig) (OKEH08090)

OKEH08090 96 Wells
EUR 1092.00
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Rab14, Member Ras Oncogene Family Antibody

20-abx114964
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB14, Member RAS Oncogene Family Protein

20-abx262905
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

RAB14 sgRNA CRISPR Lentivector set (Human)

K1771801 3 x 1.0 ug
EUR 339.00

Rab14 sgRNA CRISPR Lentivector set (Mouse)

K4613501 3 x 1.0 ug
EUR 339.00

Rab14 sgRNA CRISPR Lentivector set (Rat)

K7050301 3 x 1.0 ug
EUR 339.00

Ras-Related Protein Rab-14 (RAB14) Antibody

abx036226-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-14 (RAB14) Antibody

20-abx007777
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Ras-related protein Rab-14 (RAB14) Antibody

20-abx214234
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-14 (RAB14) Antibody

abx236996-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Recombinant Human RAB14, Member RAS Oncogene Family

7-06007 2µg Ask for price

Recombinant Human RAB14, Member RAS Oncogene Family

7-06008 10µg Ask for price

Recombinant Human RAB14, Member RAS Oncogene Family

7-06009 1mg Ask for price

RAB14 sgRNA CRISPR Lentivector (Human) (Target 1)

K1771802 1.0 ug DNA
EUR 154.00

RAB14 sgRNA CRISPR Lentivector (Human) (Target 2)

K1771803 1.0 ug DNA
EUR 154.00

RAB14 sgRNA CRISPR Lentivector (Human) (Target 3)

K1771804 1.0 ug DNA
EUR 154.00

Rab14 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4613502 1.0 ug DNA
EUR 154.00

Rab14 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4613503 1.0 ug DNA
EUR 154.00

Rab14 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4613504 1.0 ug DNA
EUR 154.00

Rab14 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7050302 1.0 ug DNA
EUR 154.00

Rab14 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7050303 1.0 ug DNA
EUR 154.00

Rab14 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7050304 1.0 ug DNA
EUR 154.00

Recombinant Human RAB14 Protein, His, E.coli-10ug

QP13230-10ug 10ug
EUR 201.00

Recombinant Human RAB14 Protein, His, E.coli-1mg

QP13230-1mg 1mg
EUR 5251.00

Recombinant Human RAB14 Protein, His, E.coli-2ug

QP13230-2ug 2ug
EUR 155.00

RAB14 Protein Vector (Human) (pPB-C-His)

PV033889 500 ng
EUR 329.00

RAB14 Protein Vector (Human) (pPB-N-His)

PV033890 500 ng
EUR 329.00

RAB14 Protein Vector (Human) (pPM-C-HA)

PV033891 500 ng
EUR 329.00

RAB14 Protein Vector (Human) (pPM-C-His)

PV033892 500 ng
EUR 329.00

RAB14 Protein Vector (Rat) (pPB-C-His)

PV297670 500 ng
EUR 603.00

RAB14 Protein Vector (Rat) (pPB-N-His)

PV297671 500 ng
EUR 603.00

RAB14 Protein Vector (Rat) (pPM-C-HA)

PV297672 500 ng
EUR 603.00

RAB14 Protein Vector (Rat) (pPM-C-His)

PV297673 500 ng
EUR 603.00

RAB14 Protein Vector (Mouse) (pPB-C-His)

PV221598 500 ng
EUR 603.00

RAB14 Protein Vector (Mouse) (pPB-N-His)

PV221599 500 ng
EUR 603.00

RAB14 Protein Vector (Mouse) (pPM-C-HA)

PV221600 500 ng
EUR 603.00

RAB14 Protein Vector (Mouse) (pPM-C-His)

PV221601 500 ng
EUR 603.00

Rab14 3'UTR GFP Stable Cell Line

TU167391 1.0 ml Ask for price