RAB14 siRNA
20-abx904412	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RAB14 siRNA
20-abx930601	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RAB14 siRNA
20-abx930602	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RAB14 antibody
70R-51381	Fitzgerald	100 ul	EUR 244.00
Description: Purified Polyclonal RAB14 antibody

RAB14 Antibody
37854-100ul	SAB	100ul	EUR 252.00

RAB14 antibody
70R-19686	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal RAB14 antibody

RAB14 antibody
70R-10565	Fitzgerald	50 ug	EUR 467.00
Description: Affinity purified rabbit polyclonal RAB14 antibody

RAB14 Antibody
DF12460	Affbiotech	200ul	EUR 304.00
Description: RAB14 antibody detects endogenous levels of RAB14.

RAB14 Antibody
1-CSB-PA793696	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB14. Recognizes RAB14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:300

RAB14 Antibody
1-CSB-PA019162GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAB14. Recognizes RAB14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RAB14 Conjugated Antibody
C37854	SAB	100ul	EUR 397.00

RAB14 cloning plasmid
CSB-CL019162HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 648 Sequence: atggcaactgcaccatacaactactcttacatctttaaatatattattattggggacatgggagtaggaaaatcttgcttgcttcatcaatttacagaaaaaaaatttatggctgattgtcctcacacaattggtgttgaatttggtacaagaataatcgaagttagtggccaaaa Show more
Description: A cloning plasmid for the RAB14 gene.

RAB14 Polyclonal Antibody
ES11931-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against RAB14 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB14 Polyclonal Antibody
ES11931-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against RAB14 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- RAB14 antibody
FNab06996	FN Test	100µg	EUR 505.25
Immunogen: RAB14, member RAS oncogene family Uniprot ID: P61106 Gene ID: 51552 Research Area: Signal Transduction
Description: Antibody raised against RAB14

RAB14 Blocking Peptide
20-abx064256	Abbexa	EUR 272.00 EUR 411.00	0 1
Shipped within 5-10 working days.

RAB14 Polyclonal Antibody
ABP60057-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from part region of human RAB14 protein Applications tips:
Description: A polyclonal antibody for detection of RAB14 from Human, Mouse, Rat. This RAB14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB14 protein

RAB14 Polyclonal Antibody
ABP60057-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from part region of human RAB14 protein Applications tips:
Description: A polyclonal antibody for detection of RAB14 from Human, Mouse, Rat. This RAB14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB14 protein

RAB14 Polyclonal Antibody
ABP60057-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from part region of human RAB14 protein Applications tips:
Description: A polyclonal antibody for detection of RAB14 from Human, Mouse, Rat. This RAB14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB14 protein

RAB14 Rabbit pAb
A12752-100ul	Abclonal	100 ul	EUR 308.00

RAB14 Rabbit pAb
A12752-200ul	Abclonal	200 ul	EUR 459.00

RAB14 Rabbit pAb
A12752-20ul	Abclonal	20 ul	EUR 183.00

RAB14 Rabbit pAb
A12752-50ul	Abclonal	50 ul	EUR 223.00

RAB14 Blocking Peptide
33R-2956	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB14 antibody, catalog no. 70R-10565

RAB14 Blocking Peptide
DF12460-BP	Affbiotech	1mg	EUR 195.00

Anti-RAB14 Antibody
PB9815	BosterBio	100ug/vial	EUR 294.00

Anti-RAB14 antibody
PAab06996	Lifescience Market	100 ug	EUR 355.00

Anti-RAB14 antibody
STJ114625	St John's Laboratory	100 µl	EUR 277.00

Anti-Rab14 antibody
STJ140070	St John's Laboratory	100 µg	EUR 219.00
Description: RAB14 belongs to the large RAB family of low molecular weight GTPases that are involved in intracellular membrane trafficking. This protein is expressed at high levels in kidney, lung, brain, spleen and thymus and it is thought to be involved in vesicular trafficking and neurotransmitter release. It is also involved in the biosynthetic/recycling pathway between the Golgi and endosomal compartments.

Anti-Rab14 antibody
STJ140071	St John's Laboratory	100 µg	EUR 219.00
Description: RAB14 belongs to the large RAB family of low molecular weight GTPases that are involved in intracellular membrane trafficking. This protein is expressed at high levels in kidney, lung, brain, spleen and thymus and it is thought to be involved in vesicular trafficking and neurotransmitter release. It is also involved in the biosynthetic/recycling pathway between the Golgi and endosomal compartments.

Anti-RAB14 antibody
STJ193089	St John's Laboratory	200 µl	EUR 197.00
Description: Unconjugated Rabbit polyclonal to RAB14

Mouse RAB14 shRNA Plasmid
20-abx976596	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat RAB14 shRNA Plasmid
20-abx987085	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human RAB14 ELISA Kit
ELA-E14990h	Lifescience Market	96 Tests	EUR 824.00

RAB14 ELISA KIT|Human
EF005847	Lifescience Market	96 Tests	EUR 689.00

Human RAB14 shRNA Plasmid
20-abx959827	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

RAB14 protein (His tag)
80R-1866	Fitzgerald	50 ug	EUR 305.00
Description: Purified recombinant RAB14 protein

RAB14 Recombinant Protein (Human)
RP025417	ABM	100 ug	Ask for price

RAB14 Recombinant Protein (Rat)
RP223250	ABM	100 ug	Ask for price

RAB14 Recombinant Protein (Mouse)
RP166196	ABM	100 ug	Ask for price

Monoclonal RAB14 Antibody, Clone: 1779CT692.32.86
AMM07435G	Leading Biology	0.1ml	EUR 484.00
Description: A Monoclonal antibody against Human RAB14. The antibodies are raised in Mouse and are from clone 1779CT692.32.86. This antibody is applicable in WB, E

RAB14 ORF Vector (Human) (pORF)
ORF008473	ABM	1.0 ug DNA	EUR 95.00

Rab14 ORF Vector (Rat) (pORF)
ORF074418	ABM	1.0 ug DNA	EUR 506.00

Rab14 ORF Vector (Mouse) (pORF)
ORF055400	ABM	1.0 ug DNA	EUR 506.00

RAB14 Western Blot kit (AWBK13107)
AWBK13107	Aviva Systems Biology	10 reactions	EUR 647.00
Description: Description of target: Species reactivity: Application: Assay info: Sensitivity:

RAB14 ELISA Kit (Human) (OKEH02419)
OKEH02419	Aviva Systems Biology	96 Wells	EUR 779.00
Description: Description of target: RAB14 belongs to the large RAB family of low molecular mass GTPases that are involved in intracellular membrane trafficking. These proteins act as molecular switches that flip between an inactive GDP-bound state and an active GTP-bound state in which they recruit downstream effector proteins onto membranes (Junutula et al., 2004 [PubMed 15004230]).[supplied by OMIM, Mar 2009];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.18 ng/mL

RAB14 ELISA Kit (Chicken) (OKEH08089)
OKEH08089	Aviva Systems Biology	96 Wells	EUR 1184.00
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

RAB14 ELISA Kit (Pig) (OKEH08090)
OKEH08090	Aviva Systems Biology	96 Wells	EUR 1092.00
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Rab14, Member Ras Oncogene Family Antibody
20-abx114964	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

RAB14, Member RAS Oncogene Family Protein
20-abx262905	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	0 1 2
Shipped within 5-10 working days.

RAB14 sgRNA CRISPR Lentivector set (Human)
K1771801	ABM	3 x 1.0 ug	EUR 339.00

Rab14 sgRNA CRISPR Lentivector set (Mouse)
K4613501	ABM	3 x 1.0 ug	EUR 339.00

Rab14 sgRNA CRISPR Lentivector set (Rat)
K7050301	ABM	3 x 1.0 ug	EUR 339.00

Ras-Related Protein Rab-14 (RAB14) Antibody
abx036226-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Ras-Related Protein Rab-14 (RAB14) Antibody
20-abx007777	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	0 1 2
Shipped within 5-10 working days.

Ras-related protein Rab-14 (RAB14) Antibody
20-abx214234	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Ras-Related Protein Rab-14 (RAB14) Antibody
abx236996-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Recombinant Human RAB14, Member RAS Oncogene Family
7-06007	CHI Scientific	2µg	Ask for price

Recombinant Human RAB14, Member RAS Oncogene Family
7-06008	CHI Scientific	10µg	Ask for price

Recombinant Human RAB14, Member RAS Oncogene Family
7-06009	CHI Scientific	1mg	Ask for price

RAB14 sgRNA CRISPR Lentivector (Human) (Target 1)
K1771802	ABM	1.0 ug DNA	EUR 154.00

RAB14 sgRNA CRISPR Lentivector (Human) (Target 2)
K1771803	ABM	1.0 ug DNA	EUR 154.00

RAB14 sgRNA CRISPR Lentivector (Human) (Target 3)
K1771804	ABM	1.0 ug DNA	EUR 154.00

Rab14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4613502	ABM	1.0 ug DNA	EUR 154.00

Rab14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4613503	ABM	1.0 ug DNA	EUR 154.00

Rab14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4613504	ABM	1.0 ug DNA	EUR 154.00

Rab14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7050302	ABM	1.0 ug DNA	EUR 154.00

Rab14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7050303	ABM	1.0 ug DNA	EUR 154.00

Rab14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7050304	ABM	1.0 ug DNA	EUR 154.00

Recombinant Human RAB14 Protein, His, E.coli-10ug
QP13230-10ug	EnQuireBio	10ug	EUR 201.00

Recombinant Human RAB14 Protein, His, E.coli-1mg
QP13230-1mg	EnQuireBio	1mg	EUR 5251.00

Recombinant Human RAB14 Protein, His, E.coli-2ug
QP13230-2ug	EnQuireBio	2ug	EUR 155.00

RAB14 Protein Vector (Human) (pPB-C-His)
PV033889	ABM	500 ng	EUR 329.00

RAB14 Protein Vector (Human) (pPB-N-His)
PV033890	ABM	500 ng	EUR 329.00

RAB14 Protein Vector (Human) (pPM-C-HA)
PV033891	ABM	500 ng	EUR 329.00

RAB14 Protein Vector (Human) (pPM-C-His)
PV033892	ABM	500 ng	EUR 329.00

RAB14 Protein Vector (Rat) (pPB-C-His)
PV297670	ABM	500 ng	EUR 603.00

RAB14 Protein Vector (Rat) (pPB-N-His)
PV297671	ABM	500 ng	EUR 603.00

RAB14 Protein Vector (Rat) (pPM-C-HA)
PV297672	ABM	500 ng	EUR 603.00

RAB14 Protein Vector (Rat) (pPM-C-His)
PV297673	ABM	500 ng	EUR 603.00

RAB14 Protein Vector (Mouse) (pPB-C-His)
PV221598	ABM	500 ng	EUR 603.00

RAB14 Protein Vector (Mouse) (pPB-N-His)
PV221599	ABM	500 ng	EUR 603.00

RAB14 Protein Vector (Mouse) (pPM-C-HA)
PV221600	ABM	500 ng	EUR 603.00

RAB14 Protein Vector (Mouse) (pPM-C-His)
PV221601	ABM	500 ng	EUR 603.00

Rab14 3'UTR GFP Stable Cell Line
TU167391	ABM	1.0 ml	Ask for price