RAB14

RAB14 antibody
70R-19686 50 ul
EUR 435
Description: Rabbit polyclonal RAB14 antibody

RAB14 antibody
70R-10565 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RAB14 antibody

RAB14 Antibody
37854-100ul 100ul
EUR 252

RAB14 Antibody
1-CSB-PA793696
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB14. Recognizes RAB14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:300

RAB14 Antibody
DF12460 200ul
EUR 304
Description: RAB14 antibody detects endogenous levels of RAB14.

RAB14 antibody
70R-51381 100 ul
EUR 244
Description: Purified Polyclonal RAB14 antibody

RAB14 Antibody
1-CSB-PA019162GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAB14. Recognizes RAB14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RAB14 siRNA
20-abx904412
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB14 siRNA
20-abx930601
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB14 siRNA
20-abx930602
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB14 Rabbit pAb
A12752-100ul 100 ul
EUR 308

RAB14 Rabbit pAb
A12752-200ul 200 ul
EUR 459

RAB14 Rabbit pAb
A12752-20ul 20 ul
EUR 183

RAB14 Rabbit pAb
A12752-50ul 50 ul
EUR 223

RAB14 Blocking Peptide
33R-2956 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB14 antibody, catalog no. 70R-10565

RAB14 Blocking Peptide
DF12460-BP 1mg
EUR 195

RAB14 Blocking Peptide
20-abx064256
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RAB14 Conjugated Antibody
C37854 100ul
EUR 397

RAB14 cloning plasmid
CSB-CL019162HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atggcaactgcaccatacaactactcttacatctttaaatatattattattggggacatgggagtaggaaaatcttgcttgcttcatcaatttacagaaaaaaaatttatggctgattgtcctcacacaattggtgttgaatttggtacaagaataatcgaagttagtggccaaaa
  • Show more
Description: A cloning plasmid for the RAB14 gene.

RAB14 Polyclonal Antibody
ABP60057-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RAB14 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RAB14 from Human, Mouse, Rat. This RAB14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB14 protein

RAB14 Polyclonal Antibody
ABP60057-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RAB14 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RAB14 from Human, Mouse, Rat. This RAB14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB14 protein

RAB14 Polyclonal Antibody
ABP60057-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAB14 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RAB14 from Human, Mouse, Rat. This RAB14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB14 protein

anti- RAB14 antibody
FNab06996 100µg
EUR 505.25
  • Immunogen: RAB14, member RAS oncogene family
  • Uniprot ID: P61106
  • Gene ID: 51552
  • Research Area: Signal Transduction
Description: Antibody raised against RAB14

RAB14 Polyclonal Antibody
ES11931-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RAB14 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB14 Polyclonal Antibody
ES11931-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RAB14 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-RAB14 antibody
PAab06996 100 ug
EUR 355

Anti-RAB14 Antibody
PB9815 100ug/vial
EUR 294

Anti-RAB14 antibody
STJ114625 100 µl
EUR 277

Anti-Rab14 antibody
STJ140070 100 µg
EUR 219
Description: RAB14 belongs to the large RAB family of low molecular weight GTPases that are involved in intracellular membrane trafficking. This protein is expressed at high levels in kidney, lung, brain, spleen and thymus and it is thought to be involved in vesicular trafficking and neurotransmitter release. It is also involved in the biosynthetic/recycling pathway between the Golgi and endosomal compartments.

Anti-Rab14 antibody
STJ140071 100 µg
EUR 219
Description: RAB14 belongs to the large RAB family of low molecular weight GTPases that are involved in intracellular membrane trafficking. This protein is expressed at high levels in kidney, lung, brain, spleen and thymus and it is thought to be involved in vesicular trafficking and neurotransmitter release. It is also involved in the biosynthetic/recycling pathway between the Golgi and endosomal compartments.

Anti-RAB14 antibody
STJ193089 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAB14

RAB14 protein (His tag)
80R-1866 50 ug
EUR 305
Description: Purified recombinant RAB14 protein

Human RAB14 ELISA Kit
ELA-E14990h 96 Tests
EUR 824

RAB14 ELISA KIT|Human
EF005847 96 Tests
EUR 689

Mouse RAB14 shRNA Plasmid
20-abx976596
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RAB14 shRNA Plasmid
20-abx987085
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAB14 shRNA Plasmid
20-abx959827
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB14 Recombinant Protein (Human)
RP025417 100 ug Ask for price

RAB14 Recombinant Protein (Mouse)
RP166196 100 ug Ask for price

RAB14 Recombinant Protein (Rat)
RP223250 100 ug Ask for price

Monoclonal RAB14 Antibody, Clone: 1779CT692.32.86
AMM07435G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human RAB14. The antibodies are raised in Mouse and are from clone 1779CT692.32.86. This antibody is applicable in WB, E

Rab14 ORF Vector (Rat) (pORF)
ORF074418 1.0 ug DNA
EUR 506

RAB14 ORF Vector (Human) (pORF)
ORF008473 1.0 ug DNA
EUR 95

Rab14 ORF Vector (Mouse) (pORF)
ORF055400 1.0 ug DNA
EUR 506

RAB14 Western Blot kit (AWBK13107)
AWBK13107 10 reactions
EUR 647
Description:
  • Description of target:
  • Species reactivity:
  • Application:
  • Assay info:
  • Sensitivity:

RAB14 ELISA Kit (Chicken) (OKEH08089)
OKEH08089 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

RAB14 ELISA Kit (Pig) (OKEH08090)
OKEH08090 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

RAB14 ELISA Kit (Human) (OKEH02419)
OKEH02419 96 Wells
EUR 779
Description: Description of target: RAB14 belongs to the large RAB family of low molecular mass GTPases that are involved in intracellular membrane trafficking. These proteins act as molecular switches that flip between an inactive GDP-bound state and an active GTP-bound state in which they recruit downstream effector proteins onto membranes (Junutula et al., 2004 [PubMed 15004230]).[supplied by OMIM, Mar 2009];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.18 ng/mL

Rab14, Member Ras Oncogene Family Antibody
20-abx114964
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB14, Member RAS Oncogene Family Protein
20-abx262905
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Rab14 sgRNA CRISPR Lentivector set (Rat)
K7050301 3 x 1.0 ug
EUR 339

Rab14 sgRNA CRISPR Lentivector set (Mouse)
K4613501 3 x 1.0 ug
EUR 339

RAB14 sgRNA CRISPR Lentivector set (Human)
K1771801 3 x 1.0 ug
EUR 339

Recombinant Human RAB14, Member RAS Oncogene Family
7-06007 2µg Ask for price

Recombinant Human RAB14, Member RAS Oncogene Family
7-06008 10µg Ask for price

Recombinant Human RAB14, Member RAS Oncogene Family
7-06009 1mg Ask for price

Ras-Related Protein Rab-14 (RAB14) Antibody
20-abx007777
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ras-related protein Rab-14 (RAB14) Antibody
20-abx214234
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-14 (RAB14) Antibody
abx036226-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-14 (RAB14) Antibody
abx236996-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Rab14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7050302 1.0 ug DNA
EUR 154

Rab14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7050303 1.0 ug DNA
EUR 154

Rab14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7050304 1.0 ug DNA
EUR 154

Rab14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4613502 1.0 ug DNA
EUR 154

Rab14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4613503 1.0 ug DNA
EUR 154

Rab14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4613504 1.0 ug DNA
EUR 154

RAB14 sgRNA CRISPR Lentivector (Human) (Target 1)
K1771802 1.0 ug DNA
EUR 154

RAB14 sgRNA CRISPR Lentivector (Human) (Target 2)
K1771803 1.0 ug DNA
EUR 154

RAB14 sgRNA CRISPR Lentivector (Human) (Target 3)
K1771804 1.0 ug DNA
EUR 154

RAB14 Protein Vector (Rat) (pPB-C-His)
PV297670 500 ng
EUR 603

RAB14 Protein Vector (Rat) (pPB-N-His)
PV297671 500 ng
EUR 603

RAB14 Protein Vector (Rat) (pPM-C-HA)
PV297672 500 ng
EUR 603

RAB14 Protein Vector (Rat) (pPM-C-His)
PV297673 500 ng
EUR 603

RAB14 Protein Vector (Human) (pPB-C-His)
PV033889 500 ng
EUR 329

RAB14 Protein Vector (Human) (pPB-N-His)
PV033890 500 ng
EUR 329

RAB14 Protein Vector (Human) (pPM-C-HA)
PV033891 500 ng
EUR 329

RAB14 Protein Vector (Human) (pPM-C-His)
PV033892 500 ng
EUR 329

RAB14 Protein Vector (Mouse) (pPB-C-His)
PV221598 500 ng
EUR 603

RAB14 Protein Vector (Mouse) (pPB-N-His)
PV221599 500 ng
EUR 603

RAB14 Protein Vector (Mouse) (pPM-C-HA)
PV221600 500 ng
EUR 603

RAB14 Protein Vector (Mouse) (pPM-C-His)
PV221601 500 ng
EUR 603

Recombinant Human RAB14 Protein, His, E.coli-10ug
QP13230-10ug 10ug
EUR 201

Recombinant Human RAB14 Protein, His, E.coli-1mg
QP13230-1mg 1mg
EUR 5251

Recombinant Human RAB14 Protein, His, E.coli-2ug
QP13230-2ug 2ug
EUR 155

Rab14 3'UTR Luciferase Stable Cell Line
TU117391 1.0 ml Ask for price