  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB23 antibody

70R-51001 100 ul
EUR 244.00
Description: Purified Polyclonal RAB23 antibody

RAB23 antibody

70R-5787 50 ug
EUR 467.00
Description: Rabbit polyclonal RAB23 antibody raised against the N terminal of RAB23

Rab23 antibody

70R-9451 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal Rab23 antibody

RAB23 Antibody

46180-100ul 100ul
EUR 252.00

RAB23 Antibody

46180-50ul 50ul
EUR 187.00

RAB23 antibody

70R-19693 50 ul
EUR 435.00
Description: Rabbit polyclonal RAB23 antibody

RAB23 Antibody

DF9821 200ul
EUR 304.00
Description: RAB23 Antibody detects endogenous levels of total RAB23.

RAB23 Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB23. Recognizes RAB23 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAB23 Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB23. Recognizes RAB23 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RAB23 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB23. Recognizes RAB23 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


YF-PA19178 50 ul
EUR 363.00
Description: Mouse polyclonal to RAB23


YF-PA19179 50 ug
EUR 363.00
Description: Mouse polyclonal to RAB23


YF-PA19180 50 ul
EUR 363.00
Description: Mouse polyclonal to RAB23


YF-PA19181 100 ul
EUR 403.00
Description: Rabbit polyclonal to RAB23


YF-PA19182 100 ug
EUR 403.00
Description: Rabbit polyclonal to RAB23

Rab23, Member Ras Oncogene Family (RAB23) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody

abx145153-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody

  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody

  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody

  • EUR 425.00
  • EUR 342.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody

abx431545-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

RAB23, Member RAS Oncogene Family (Rab23) Antibody

abx237006-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

RAB23 Conjugated Antibody

C46180 100ul
EUR 397.00

anti- Rab23 antibody

FNab07006 100µg
EUR 505.25
  • Immunogen: RAB23, member RAS oncogene family
  • Uniprot ID: Q9ULC3
  • Gene ID: 51715
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against Rab23

RAB23 Polyclonal Antibody

ES10118-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against RAB23 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB23 Polyclonal Antibody

ES10118-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against RAB23 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB23 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB23 Polyclonal Antibody

ABP60063-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB23 protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of RAB23 from Human. This RAB23 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB23 protein at amino acid sequence of 120-200

RAB23 Polyclonal Antibody

ABP60063-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB23 protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of RAB23 from Human. This RAB23 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB23 protein at amino acid sequence of 120-200

RAB23 Polyclonal Antibody

ABP60063-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB23 protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of RAB23 from Human. This RAB23 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB23 protein at amino acid sequence of 120-200

RAB23 Rabbit pAb

A7979-100ul 100 ul
EUR 308.00

RAB23 Rabbit pAb

A7979-200ul 200 ul
EUR 459.00

RAB23 Rabbit pAb

A7979-20ul 20 ul
EUR 183.00

RAB23 Rabbit pAb

A7979-50ul 50 ul
EUR 223.00

Rab23 Blocking Peptide

33R-2100 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Rab23 antibody, catalog no. 70R-9451

RAB23 Blocking Peptide

33R-9136 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB23 antibody, catalog no. 70R-5787

Human RAB23 Antibody

33318-05111 150 ug
EUR 261.00

RAB23 Blocking Peptide

DF9821-BP 1mg
EUR 195.00

RAB23 cloning plasmid

CSB-CL891960HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 714
  • Sequence: atgttggaggaagatatggaagtcgccataaagatggtggttgtagggaatggagcagttggaaaatcaagtatgattcagcgatattgcaaaggcatttttacaaaagactacaagaaaaccattggagttgattttttggagcgacaaattcaagttaatgatgaagatgtcag
  • Show more
Description: A cloning plasmid for the RAB23 gene.

Anti-Rab23 antibody

PAab07006 100 ug
EUR 355.00


PVT13991 2 ug
EUR 391.00

Anti-RAB23 antibody

STJ71452 100 µg
EUR 359.00

Anti-RAB23 antibody

STJ110286 100 µl
EUR 277.00
Description: This gene encodes a small GTPase of the Ras superfamily. Rab proteins are involved in the regulation of diverse cellular functions associated with intracellular membrane trafficking, including autophagy and immune response to bacterial infection. The encoded protein may play a role in central nervous system development by antagonizing sonic hedgehog signaling. Disruption of this gene has been implicated in Carpenter syndrome as well as cancer. Alternative splicing results in multiple transcript variants.

Anti-RAB23 antibody

STJ191276 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to RAB23

Rab23 ELISA KIT|Human

EF002224 96 Tests
EUR 689.00

Human RAB23 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RAB23 protein (His tag)

80R-2032 100 ug
EUR 322.00
Description: Recombinant human RAB23 protein (His tag)

RAB23 Recombinant Protein (Human)

RP025444 100 ug Ask for price

RAB23 Recombinant Protein (Rat)

RP223277 100 ug Ask for price

RAB23 Recombinant Protein (Mouse)

RP166226 100 ug Ask for price

RAB23 Recombinant Protein (Mouse)

RP166229 100 ug Ask for price

Polyclonal Goat Anti-RAB23 Antibody

AMM05952G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-RAB23 . This antibody is tested and proven to work in the following applications:

Polyclonal Rab23 antibody - middle region

APR13043G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rab23 - middle region. This antibody is tested and proven to work in the following applications:

Human RAB23 Antibody (Biotin Conjugate)

33318-05121 150 ug
EUR 369.00

RAB23 ORF Vector (Human) (pORF)

ORF008482 1.0 ug DNA
EUR 95.00

Rab23 ORF Vector (Rat) (pORF)

ORF074427 1.0 ug DNA
EUR 506.00

Rab23 ORF Vector (Mouse) (pORF)

ORF055410 1.0 ug DNA
EUR 506.00

Rab23 ORF Vector (Mouse) (pORF)

ORF055411 1.0 ug DNA
EUR 506.00

RAB23, Member RAS Oncogene Family Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Human RAB23 AssayLite Antibody (FITC Conjugate)

33318-05141 150 ug
EUR 428.00

Human RAB23 AssayLite Antibody (RPE Conjugate)

33318-05151 150 ug
EUR 428.00

Human RAB23 AssayLite Antibody (APC Conjugate)

33318-05161 150 ug
EUR 428.00

Human RAB23 AssayLite Antibody (PerCP Conjugate)

33318-05171 150 ug
EUR 471.00

RAB23 sgRNA CRISPR Lentivector set (Human)

K1772601 3 x 1.0 ug
EUR 339.00

Rab23 sgRNA CRISPR Lentivector set (Mouse)

K4787401 3 x 1.0 ug
EUR 339.00

Rab23 sgRNA CRISPR Lentivector set (Rat)

K6513601 3 x 1.0 ug
EUR 339.00

RAB23 sgRNA CRISPR Lentivector (Human) (Target 1)

K1772602 1.0 ug DNA
EUR 154.00

RAB23 sgRNA CRISPR Lentivector (Human) (Target 2)

K1772603 1.0 ug DNA
EUR 154.00

RAB23 sgRNA CRISPR Lentivector (Human) (Target 3)

K1772604 1.0 ug DNA
EUR 154.00

Rab23 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4787402 1.0 ug DNA
EUR 154.00

Rab23 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4787403 1.0 ug DNA
EUR 154.00

Rab23 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4787404 1.0 ug DNA
EUR 154.00

Human Ras-related protein Rab-23 (RAB23)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 53.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-23(RAB23) expressed in E.coli

Rab23 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6513602 1.0 ug DNA
EUR 154.00

Rab23 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6513603 1.0 ug DNA
EUR 154.00

Rab23 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6513604 1.0 ug DNA
EUR 154.00

RAB23 Protein Vector (Human) (pPB-C-His)

PV033925 500 ng
EUR 329.00

RAB23 Protein Vector (Human) (pPB-N-His)

PV033926 500 ng
EUR 329.00

RAB23 Protein Vector (Human) (pPM-C-HA)

PV033927 500 ng
EUR 329.00

RAB23 Protein Vector (Human) (pPM-C-His)

PV033928 500 ng
EUR 329.00

RAB23 Protein Vector (Rat) (pPB-C-His)

PV297706 500 ng
EUR 603.00

RAB23 Protein Vector (Rat) (pPB-N-His)

PV297707 500 ng
EUR 603.00