RAB23

RAB23 siRNA
20-abx930621	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RAB23 antibody
70R-51001	Fitzgerald	100 ul	EUR 244.00
Description: Purified Polyclonal RAB23 antibody

RAB23 antibody
70R-5787	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal RAB23 antibody raised against the N terminal of RAB23

Rab23 antibody
70R-9451	Fitzgerald	50 ug	EUR 467.00
Description: Affinity purified rabbit polyclonal Rab23 antibody

RAB23 Antibody
46180-100ul	SAB	100ul	EUR 252.00

RAB23 Antibody
46180-50ul	SAB	50ul	EUR 187.00

RAB23 antibody
70R-19693	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal RAB23 antibody

RAB23 Antibody
DF9821	Affbiotech	200ul	EUR 304.00
Description: RAB23 Antibody detects endogenous levels of total RAB23.

RAB23 Antibody
1-CSB-PA891960ESR1HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB23. Recognizes RAB23 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAB23 Antibody
1-CSB-PA891960ESR2HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB23. Recognizes RAB23 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RAB23 Antibody
1-CSB-PA019173GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB23. Recognizes RAB23 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-RAB23
YF-PA19178	Abfrontier	50 ul	EUR 363.00
Description: Mouse polyclonal to RAB23

anti-RAB23
YF-PA19179	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to RAB23

anti-RAB23
YF-PA19180	Abfrontier	50 ul	EUR 363.00
Description: Mouse polyclonal to RAB23

anti-RAB23
YF-PA19181	Abfrontier	100 ul	EUR 403.00
Description: Rabbit polyclonal to RAB23

anti-RAB23
YF-PA19182	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to RAB23

Rab23, Member Ras Oncogene Family (RAB23) Antibody
20-abx114971	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody
abx145153-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody
20-abx007104	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody
20-abx008137	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	0 1 2
Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody
20-abx320973	Abbexa	EUR 439.00 EUR 328.00	0 1
Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody
20-abx322692	Abbexa	EUR 439.00 EUR 328.00	0 1
Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody
20-abx218115	Abbexa	EUR 425.00 EUR 342.00	0 1
Shipped within 5-10 working days.

RAB23, Member RAS Oncogene Family (RAB23) Antibody
abx431545-200ul	Abbexa	200 ul	EUR 384.00
Shipped within 1-3 working days.

RAB23, Member RAS Oncogene Family (Rab23) Antibody
abx237006-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

RAB23 Conjugated Antibody
C46180	SAB	100ul	EUR 397.00

anti- Rab23 antibody
FNab07006	FN Test	100µg	EUR 505.25
Immunogen: RAB23, member RAS oncogene family Uniprot ID: Q9ULC3 Gene ID: 51715 Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against Rab23

RAB23 Polyclonal Antibody
ES10118-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against RAB23 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB23 Polyclonal Antibody
ES10118-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against RAB23 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB23 Blocking Peptide
20-abx063876	Abbexa	EUR 272.00 EUR 411.00	0 1
Shipped within 5-10 working days.

RAB23 Polyclonal Antibody
ABP60063-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from part region of human RAB23 protein at amino acid sequence of 120-200 Applications tips:
Description: A polyclonal antibody for detection of RAB23 from Human. This RAB23 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB23 protein at amino acid sequence of 120-200

RAB23 Polyclonal Antibody
ABP60063-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from part region of human RAB23 protein at amino acid sequence of 120-200 Applications tips:
Description: A polyclonal antibody for detection of RAB23 from Human. This RAB23 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB23 protein at amino acid sequence of 120-200

RAB23 Polyclonal Antibody
ABP60063-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from part region of human RAB23 protein at amino acid sequence of 120-200 Applications tips:
Description: A polyclonal antibody for detection of RAB23 from Human. This RAB23 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB23 protein at amino acid sequence of 120-200

RAB23 Rabbit pAb
A7979-100ul	Abclonal	100 ul	EUR 308.00

RAB23 Rabbit pAb
A7979-200ul	Abclonal	200 ul	EUR 459.00

RAB23 Rabbit pAb
A7979-20ul	Abclonal	20 ul	EUR 183.00

RAB23 Rabbit pAb
A7979-50ul	Abclonal	50 ul	EUR 223.00

Rab23 Blocking Peptide
33R-2100	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Rab23 antibody, catalog no. 70R-9451

RAB23 Blocking Peptide
33R-9136	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB23 antibody, catalog no. 70R-5787

Human RAB23 Antibody
33318-05111	AssayPro	150 ug	EUR 261.00

RAB23 Blocking Peptide
DF9821-BP	Affbiotech	1mg	EUR 195.00

RAB23 cloning plasmid
CSB-CL891960HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 714 Sequence: atgttggaggaagatatggaagtcgccataaagatggtggttgtagggaatggagcagttggaaaatcaagtatgattcagcgatattgcaaaggcatttttacaaaagactacaagaaaaccattggagttgattttttggagcgacaaattcaagttaatgatgaagatgtcag Show more
Description: A cloning plasmid for the RAB23 gene.

Anti-Rab23 antibody
PAab07006	Lifescience Market	100 ug	EUR 355.00

pCMV-SPORT6-RAB23
PVT13991	Lifescience Market	2 ug	EUR 391.00

Anti-RAB23 antibody
STJ71452	St John's Laboratory	100 µg	EUR 359.00

Anti-RAB23 antibody
STJ110286	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a small GTPase of the Ras superfamily. Rab proteins are involved in the regulation of diverse cellular functions associated with intracellular membrane trafficking, including autophagy and immune response to bacterial infection. The encoded protein may play a role in central nervous system development by antagonizing sonic hedgehog signaling. Disruption of this gene has been implicated in Carpenter syndrome as well as cancer. Alternative splicing results in multiple transcript variants.

Anti-RAB23 antibody
STJ191276	St John's Laboratory	200 µl	EUR 197.00
Description: Unconjugated Rabbit polyclonal to RAB23

Rab23 ELISA KIT|Human
EF002224	Lifescience Market	96 Tests	EUR 689.00

Human RAB23 shRNA Plasmid
20-abx959915	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

RAB23 protein (His tag)
80R-2032	Fitzgerald	100 ug	EUR 322.00
Description: Recombinant human RAB23 protein (His tag)

RAB23 Recombinant Protein (Human)
RP025444	ABM	100 ug	Ask for price

RAB23 Recombinant Protein (Rat)
RP223277	ABM	100 ug	Ask for price

RAB23 Recombinant Protein (Mouse)
RP166226	ABM	100 ug	Ask for price

RAB23 Recombinant Protein (Mouse)
RP166229	ABM	100 ug	Ask for price

Polyclonal Goat Anti-RAB23 Antibody
AMM05952G	Leading Biology	0.1 mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-RAB23 . This antibody is tested and proven to work in the following applications:

Polyclonal Rab23 antibody - middle region
APR13043G	Leading Biology	0.05mg	EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rab23 - middle region. This antibody is tested and proven to work in the following applications:

Human RAB23 Antibody (Biotin Conjugate)
33318-05121	AssayPro	150 ug	EUR 369.00

RAB23 ORF Vector (Human) (pORF)
ORF008482	ABM	1.0 ug DNA	EUR 95.00

Rab23 ORF Vector (Rat) (pORF)
ORF074427	ABM	1.0 ug DNA	EUR 506.00

Rab23 ORF Vector (Mouse) (pORF)
ORF055410	ABM	1.0 ug DNA	EUR 506.00

Rab23 ORF Vector (Mouse) (pORF)
ORF055411	ABM	1.0 ug DNA	EUR 506.00

RAB23, Member RAS Oncogene Family Protein
20-abx261518	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	0 1 2
Shipped within 5-10 working days.

Human RAB23 AssayLite Antibody (FITC Conjugate)
33318-05141	AssayPro	150 ug	EUR 428.00

Human RAB23 AssayLite Antibody (RPE Conjugate)
33318-05151	AssayPro	150 ug	EUR 428.00

Human RAB23 AssayLite Antibody (APC Conjugate)
33318-05161	AssayPro	150 ug	EUR 428.00

Human RAB23 AssayLite Antibody (PerCP Conjugate)
33318-05171	AssayPro	150 ug	EUR 471.00

RAB23 sgRNA CRISPR Lentivector set (Human)
K1772601	ABM	3 x 1.0 ug	EUR 339.00

Rab23 sgRNA CRISPR Lentivector set (Mouse)
K4787401	ABM	3 x 1.0 ug	EUR 339.00

Rab23 sgRNA CRISPR Lentivector set (Rat)
K6513601	ABM	3 x 1.0 ug	EUR 339.00

RAB23 sgRNA CRISPR Lentivector (Human) (Target 1)
K1772602	ABM	1.0 ug DNA	EUR 154.00

RAB23 sgRNA CRISPR Lentivector (Human) (Target 2)
K1772603	ABM	1.0 ug DNA	EUR 154.00

RAB23 sgRNA CRISPR Lentivector (Human) (Target 3)
K1772604	ABM	1.0 ug DNA	EUR 154.00

Rab23 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4787402	ABM	1.0 ug DNA	EUR 154.00

Rab23 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4787403	ABM	1.0 ug DNA	EUR 154.00

Rab23 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4787404	ABM	1.0 ug DNA	EUR 154.00

Human Ras-related protein Rab-23 (RAB23)
1-CSB-EP891960HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	0 1 2 3 4 5
MW: 53.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-23(RAB23) expressed in E.coli

Rab23 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6513602	ABM	1.0 ug DNA	EUR 154.00

Rab23 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6513603	ABM	1.0 ug DNA	EUR 154.00

Rab23 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6513604	ABM	1.0 ug DNA	EUR 154.00

RAB23 Protein Vector (Human) (pPB-C-His)
PV033925	ABM	500 ng	EUR 329.00

RAB23 Protein Vector (Human) (pPB-N-His)
PV033926	ABM	500 ng	EUR 329.00

RAB23 Protein Vector (Human) (pPM-C-HA)
PV033927	ABM	500 ng	EUR 329.00

RAB23 Protein Vector (Human) (pPM-C-His)
PV033928	ABM	500 ng	EUR 329.00

RAB23 Protein Vector (Rat) (pPB-C-His)
PV297706	ABM	500 ng	EUR 603.00

RAB23 Protein Vector (Rat) (pPB-N-His)
PV297707	ABM	500 ng	EUR 603.00