RAB30 Antibody
46182-50ul	SAB	50ul	EUR 187.00

RAB30 Antibody
1-CSB-PA613602LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity purified
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAB30 Antibody
DF9824	Affbiotech	200ul	EUR 304.00
Description: RAB30 Antibody detects endogenous levels of total RAB30.

RAB30 antibody
70R-50949	Fitzgerald	100 ul	EUR 244.00
Description: Purified Polyclonal RAB30 antibody

RAB30 siRNA
20-abx930638	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RAB30 siRNA
20-abx930639	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RAB30 Antibody
ABD9824	Lifescience Market	100 ug	EUR 438.00

RAB30 Blocking Peptide
DF9824-BP	Affbiotech	1mg	EUR 195.00

RAB30 Blocking Peptide
20-abx063824	Abbexa	EUR 272.00 EUR 411.00	0 1
Shipped within 5-10 working days.

RAB30 Conjugated Antibody
C46182	SAB	100ul	EUR 397.00

RAB30 Antibody (HRP)
20-abx306784	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

RAB30 Antibody (FITC)
20-abx306785	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

RAB30 Antibody (Biotin)
20-abx306786	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

RAB30 cloning plasmid
CSB-CL613602HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 612 Sequence: atgagtatggaagattatgatttcctgttcaaaattgttttaattggcaacgctggtgtggggaagacgtgcctcgtccgaagattcactcagggtcttttccccccaggtcaaggagccacaattggagttgattttatgattaagacagtggagattaatggtgaaaaagtaaa Show more
Description: A cloning plasmid for the RAB30 gene.

RAB30 Polyclonal Antibody
A50889	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

RAB30 Polyclonal Antibody
ABP60065-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160 Applications tips:
Description: A polyclonal antibody for detection of RAB30 from Human, Mouse. This RAB30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160

RAB30 Polyclonal Antibody
ABP60065-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160 Applications tips:
Description: A polyclonal antibody for detection of RAB30 from Human, Mouse. This RAB30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160

RAB30 Polyclonal Antibody
ABP60065-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160 Applications tips:
Description: A polyclonal antibody for detection of RAB30 from Human, Mouse. This RAB30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160

RAB30 Polyclonal Antibody
ES10121-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against RAB30 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB30 Polyclonal Antibody
ES10121-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against RAB30 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-RAB30 antibody
STJ191279	St John's Laboratory	200 µl	EUR 197.00
Description: Unconjugated Rabbit polyclonal to RAB30

Anti-RAB30 (3G7)
YF-MA18200	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to RAB30

RAB30 Antibody, HRP conjugated
1-CSB-PA613602LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity purified
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB30 Antibody, FITC conjugated
1-CSB-PA613602LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB30 Antibody, Biotin conjugated
1-CSB-PA613602LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse RAB30 shRNA Plasmid
20-abx978533	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human RAB30 shRNA Plasmid
20-abx959073	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

RAB30 Recombinant Protein (Human)
RP025468	ABM	100 ug	Ask for price

RAB30 Recombinant Protein (Mouse)
RP166259	ABM	100 ug	Ask for price

RAB30 Recombinant Protein (Rat)
RP223304	ABM	100 ug	Ask for price

RAB30 Polyclonal Antibody, HRP Conjugated
A50890	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

RAB30 Polyclonal Antibody, FITC Conjugated
A50891	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

RAB30 Polyclonal Antibody, Biotin Conjugated
A50892	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Rab30 ORF Vector (Rat) (pORF)
ORF074436	ABM	1.0 ug DNA	EUR 506.00

RAB30 ORF Vector (Human) (pORF)
ORF008490	ABM	1.0 ug DNA	EUR 95.00

Rab30 ORF Vector (Mouse) (pORF)
ORF055421	ABM	1.0 ug DNA	EUR 506.00

Polyclonal RAB30 Antibody - C-terminal region
AMM07464G	Leading Biology	0.05mg	EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB30 - C-terminal region. This antibody is tested and proven to work in the following applications:

Rab30 sgRNA CRISPR Lentivector set (Mouse)
K4755101	ABM	3 x 1.0 ug	EUR 339.00

Rab30 sgRNA CRISPR Lentivector set (Rat)
K7217201	ABM	3 x 1.0 ug	EUR 339.00

RAB30 sgRNA CRISPR Lentivector set (Human)
K1773201	ABM	3 x 1.0 ug	EUR 339.00

Ras-Related Protein Rab-30 (RAB30) Antibody
20-abx008189	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	0 1 2
Shipped within 5-10 working days.

Ras-Related Protein Rab-30 (RAB30) Antibody
20-abx218119	Abbexa	EUR 425.00 EUR 342.00	0 1
Shipped within 5-10 working days.

Ras-Related Protein Rab-30 (RAB30) Antibody
20-abx306783	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Rab30 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4755102	ABM	1.0 ug DNA	EUR 154.00

Rab30 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4755103	ABM	1.0 ug DNA	EUR 154.00

Rab30 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4755104	ABM	1.0 ug DNA	EUR 154.00

Rab30 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7217202	ABM	1.0 ug DNA	EUR 154.00

Rab30 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7217203	ABM	1.0 ug DNA	EUR 154.00

Rab30 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7217204	ABM	1.0 ug DNA	EUR 154.00

RAB30 sgRNA CRISPR Lentivector (Human) (Target 1)
K1773202	ABM	1.0 ug DNA	EUR 154.00

RAB30 sgRNA CRISPR Lentivector (Human) (Target 2)
K1773203	ABM	1.0 ug DNA	EUR 154.00

RAB30 sgRNA CRISPR Lentivector (Human) (Target 3)
K1773204	ABM	1.0 ug DNA	EUR 154.00

RAB30 Protein Vector (Rat) (pPB-C-His)
PV297742	ABM	500 ng	EUR 603.00

RAB30 Protein Vector (Rat) (pPB-N-His)
PV297743	ABM	500 ng	EUR 603.00

RAB30 Protein Vector (Rat) (pPM-C-HA)
PV297744	ABM	500 ng	EUR 603.00

RAB30 Protein Vector (Rat) (pPM-C-His)
PV297745	ABM	500 ng	EUR 603.00

RAB30 Protein Vector (Human) (pPB-C-His)
PV033957	ABM	500 ng	EUR 329.00

RAB30 Protein Vector (Human) (pPB-N-His)
PV033958	ABM	500 ng	EUR 329.00

RAB30 Protein Vector (Human) (pPM-C-HA)
PV033959	ABM	500 ng	EUR 329.00

RAB30 Protein Vector (Human) (pPM-C-His)
PV033960	ABM	500 ng	EUR 329.00

RAB30 Protein Vector (Mouse) (pPB-C-His)
PV221682	ABM	500 ng	EUR 603.00

RAB30 Protein Vector (Mouse) (pPB-N-His)
PV221683	ABM	500 ng	EUR 603.00

RAB30 Protein Vector (Mouse) (pPM-C-HA)
PV221684	ABM	500 ng	EUR 603.00

RAB30 Protein Vector (Mouse) (pPM-C-His)
PV221685	ABM	500 ng	EUR 603.00

Rab30 3'UTR Luciferase Stable Cell Line
TU117409	ABM	1.0 ml	Ask for price

Rab30 3'UTR GFP Stable Cell Line
TU167409	ABM	1.0 ml	Ask for price

Rab30 3'UTR Luciferase Stable Cell Line
TU217194	ABM	1.0 ml	Ask for price

Rab30 3'UTR GFP Stable Cell Line
TU267194	ABM	1.0 ml	Ask for price

RAB30 3'UTR GFP Stable Cell Line
TU069383	ABM	1.0 ml	EUR 1394.00

RAB30 3'UTR Luciferase Stable Cell Line
TU019383	ABM	1.0 ml	EUR 1394.00

RAB30 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV629575	ABM	1.0 ug DNA	EUR 514.00

RAB30 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV629579	ABM	1.0 ug DNA	EUR 514.00

RAB30 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV629580	ABM	1.0 ug DNA	EUR 514.00

Mouse Ras- related protein Rab- 30, Rab30 ELISA KIT
ELI-44464m	Lifescience Market	96 Tests	EUR 865.00

Bovine Ras- related protein Rab- 30, RAB30 ELISA KIT
ELI-36015b	Lifescience Market	96 Tests	EUR 928.00

Human Ras- related protein Rab- 30, RAB30 ELISA KIT
ELI-36820h	Lifescience Market	96 Tests	EUR 824.00

Rab30 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4755105	ABM	3 x 1.0 ug	EUR 376.00

Rab30 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7217205	ABM	3 x 1.0 ug	EUR 376.00

RAB30 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1773205	ABM	3 x 1.0 ug	EUR 376.00

Rab30 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4755106	ABM	1.0 ug DNA	EUR 167.00

Rab30 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4755107	ABM	1.0 ug DNA	EUR 167.00

Rab30 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4755108	ABM	1.0 ug DNA	EUR 167.00

RAB30 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV629576	ABM	1.0 ug DNA	EUR 514.00

RAB30 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV629577	ABM	1.0 ug DNA	EUR 572.00

RAB30 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV629578	ABM	1.0 ug DNA	EUR 572.00