RAB30 Antibody

46182-50ul 50ul
EUR 187

RAB30 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity purified
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAB30 Antibody

DF9824 200ul
EUR 304
Description: RAB30 Antibody detects endogenous levels of total RAB30.

RAB30 antibody

70R-50949 100 ul
EUR 244
Description: Purified Polyclonal RAB30 antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB30 Antibody

ABD9824 100 ug
EUR 438

RAB30 Blocking Peptide

DF9824-BP 1mg
EUR 195

RAB30 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RAB30 Conjugated Antibody

C46182 100ul
EUR 397

RAB30 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB30 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB30 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB30 cloning plasmid

CSB-CL613602HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 612
  • Sequence: atgagtatggaagattatgatttcctgttcaaaattgttttaattggcaacgctggtgtggggaagacgtgcctcgtccgaagattcactcagggtcttttccccccaggtcaaggagccacaattggagttgattttatgattaagacagtggagattaatggtgaaaaagtaaa
  • Show more
Description: A cloning plasmid for the RAB30 gene.

RAB30 Polyclonal Antibody

A50889 100 µg
EUR 570.55
Description: The best epigenetics products

RAB30 Polyclonal Antibody

ABP60065-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RAB30 from Human, Mouse. This RAB30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160

RAB30 Polyclonal Antibody

ABP60065-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RAB30 from Human, Mouse. This RAB30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160

RAB30 Polyclonal Antibody

ABP60065-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RAB30 from Human, Mouse. This RAB30 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB30 protein at amino acid sequence of 80-160

RAB30 Polyclonal Antibody

ES10121-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RAB30 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB30 Polyclonal Antibody

ES10121-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RAB30 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-RAB30 antibody

STJ191279 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAB30

Anti-RAB30 (3G7)

YF-MA18200 100 ug
EUR 363
Description: Mouse monoclonal to RAB30

RAB30 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity purified
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB30 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB30 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against RAB30. Recognizes RAB30 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse RAB30 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAB30 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB30 Recombinant Protein (Human)

RP025468 100 ug Ask for price

RAB30 Recombinant Protein (Mouse)

RP166259 100 ug Ask for price

RAB30 Recombinant Protein (Rat)

RP223304 100 ug Ask for price

RAB30 Polyclonal Antibody, HRP Conjugated

A50890 100 µg
EUR 570.55
Description: kits suitable for this type of research

RAB30 Polyclonal Antibody, FITC Conjugated

A50891 100 µg
EUR 570.55
Description: fast delivery possible

RAB30 Polyclonal Antibody, Biotin Conjugated

A50892 100 µg
EUR 570.55
Description: reagents widely cited

Rab30 ORF Vector (Rat) (pORF)

ORF074436 1.0 ug DNA
EUR 506

RAB30 ORF Vector (Human) (pORF)

ORF008490 1.0 ug DNA
EUR 95

Rab30 ORF Vector (Mouse) (pORF)

ORF055421 1.0 ug DNA
EUR 506

Polyclonal RAB30 Antibody - C-terminal region

AMM07464G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB30 - C-terminal region. This antibody is tested and proven to work in the following applications:

Rab30 sgRNA CRISPR Lentivector set (Mouse)

K4755101 3 x 1.0 ug
EUR 339

Rab30 sgRNA CRISPR Lentivector set (Rat)

K7217201 3 x 1.0 ug
EUR 339

RAB30 sgRNA CRISPR Lentivector set (Human)

K1773201 3 x 1.0 ug
EUR 339

Ras-Related Protein Rab-30 (RAB30) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-30 (RAB30) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ras-Related Protein Rab-30 (RAB30) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rab30 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4755102 1.0 ug DNA
EUR 154

Rab30 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4755103 1.0 ug DNA
EUR 154

Rab30 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4755104 1.0 ug DNA
EUR 154

Rab30 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7217202 1.0 ug DNA
EUR 154

Rab30 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7217203 1.0 ug DNA
EUR 154

Rab30 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7217204 1.0 ug DNA
EUR 154

RAB30 sgRNA CRISPR Lentivector (Human) (Target 1)

K1773202 1.0 ug DNA
EUR 154

RAB30 sgRNA CRISPR Lentivector (Human) (Target 2)

K1773203 1.0 ug DNA
EUR 154

RAB30 sgRNA CRISPR Lentivector (Human) (Target 3)

K1773204 1.0 ug DNA
EUR 154

RAB30 Protein Vector (Rat) (pPB-C-His)

PV297742 500 ng
EUR 603

RAB30 Protein Vector (Rat) (pPB-N-His)

PV297743 500 ng
EUR 603

RAB30 Protein Vector (Rat) (pPM-C-HA)

PV297744 500 ng
EUR 603

RAB30 Protein Vector (Rat) (pPM-C-His)

PV297745 500 ng
EUR 603

RAB30 Protein Vector (Human) (pPB-C-His)

PV033957 500 ng
EUR 329

RAB30 Protein Vector (Human) (pPB-N-His)

PV033958 500 ng
EUR 329

RAB30 Protein Vector (Human) (pPM-C-HA)

PV033959 500 ng
EUR 329

RAB30 Protein Vector (Human) (pPM-C-His)

PV033960 500 ng
EUR 329

RAB30 Protein Vector (Mouse) (pPB-C-His)

PV221682 500 ng
EUR 603

RAB30 Protein Vector (Mouse) (pPB-N-His)

PV221683 500 ng
EUR 603

RAB30 Protein Vector (Mouse) (pPM-C-HA)

PV221684 500 ng
EUR 603

RAB30 Protein Vector (Mouse) (pPM-C-His)

PV221685 500 ng
EUR 603

Rab30 3'UTR Luciferase Stable Cell Line

TU117409 1.0 ml Ask for price

Rab30 3'UTR GFP Stable Cell Line

TU167409 1.0 ml Ask for price

Rab30 3'UTR Luciferase Stable Cell Line

TU217194 1.0 ml Ask for price

Rab30 3'UTR GFP Stable Cell Line

TU267194 1.0 ml Ask for price

RAB30 3'UTR GFP Stable Cell Line

TU069383 1.0 ml
EUR 1394

RAB30 3'UTR Luciferase Stable Cell Line

TU019383 1.0 ml
EUR 1394

RAB30 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV629575 1.0 ug DNA
EUR 514

RAB30 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV629579 1.0 ug DNA
EUR 514

RAB30 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV629580 1.0 ug DNA
EUR 514

Mouse Ras- related protein Rab- 30, Rab30 ELISA KIT

ELI-44464m 96 Tests
EUR 865

Bovine Ras- related protein Rab- 30, RAB30 ELISA KIT

ELI-36015b 96 Tests
EUR 928

Human Ras- related protein Rab- 30, RAB30 ELISA KIT

ELI-36820h 96 Tests
EUR 824

Rab30 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4755105 3 x 1.0 ug
EUR 376

Rab30 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7217205 3 x 1.0 ug
EUR 376

RAB30 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1773205 3 x 1.0 ug
EUR 376

Rab30 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4755106 1.0 ug DNA
EUR 167

Rab30 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4755107 1.0 ug DNA
EUR 167

Rab30 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4755108 1.0 ug DNA
EUR 167

RAB30 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV629576 1.0 ug DNA
EUR 514

RAB30 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV629577 1.0 ug DNA
EUR 572

RAB30 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV629578 1.0 ug DNA
EUR 572