RAB3B

RAB3B antibody

70R-19709 50 ul
EUR 435.00
Description: Rabbit polyclonal RAB3B antibody

RAB3B Antibody

1-CSB-PA019195GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAB3B. Recognizes RAB3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RAB3B Antibody

1-CSB-PA019195LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB3B. Recognizes RAB3B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAB3B siRNA

20-abx904425
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB3B siRNA

20-abx930664
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB3B siRNA

20-abx930665
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

anti-Rab3B

YF-PA14255 50 ug
EUR 363.00
Description: Mouse polyclonal to Rab3B

RAB3B, Member RAS Oncogene Family (RAB3B) Antibody

abx146128-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

RAB3B, Member RAS Oncogene Family (RAB3B) Antibody

abx237026-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

RAB3B, Member RAS Oncogene Family (RAB3B) Antibody

20-abx318530
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RAB3B, Member RAS Oncogene Family (RAB3B) Antibody (HRP)

20-abx305020
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RAB3B, Member RAS Oncogene Family (RAB3B) Antibody (FITC)

20-abx305021
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RAB3B, Member RAS Oncogene Family (RAB3B) Antibody (Biotin)

20-abx305022
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RAB3B cloning plasmid

CSB-CL019195HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 660
  • Sequence: atggcttcagtgacagatggtaaaactggagtcaaagatgcctctgaccagaattttgactacatgtttaaactgcttatcattggcaacagcagtgttggcaagacctccttcctcttccgctatgctgatgacacgttcaccccagccttcgttagcaccgtgggcatcgactt
  • Show more
Description: A cloning plasmid for the RAB3B gene.

RAB3B Polyclonal Antibody

A63262 100 µg
EUR 570.55
Description: kits suitable for this type of research

anti- RAB3B antibody

FNab07026 100µg
EUR 505.25
  • Immunogen: RAB3B, member RAS oncogene family
  • Uniprot ID: P20337
  • Gene ID: 5865
  • Research Area: Signal Transduction
Description: Antibody raised against RAB3B

Anti-RAB3B antibody

PAab07026 100 ug
EUR 355.00

Anti-Rab3B (3F12)

YF-MA10762 100 ug
EUR 363.00
Description: Mouse monoclonal to Rab3B

Anti-RAB3B (3F12)

YF-MA15080 200 ul
EUR 363.00
Description: Mouse monoclonal to RAB3B

Anti-RAB3B (1A7)

YF-MA15081 100 ug
EUR 363.00
Description: Mouse monoclonal to RAB3B

RAB3B protein (His tag)

80R-1869 100 ug
EUR 349.00
Description: Purified recombinant RAB3B protein

RAB3B ELISA KIT|Human

EF002242 96 Tests
EUR 689.00

Mouse RAB3B shRNA Plasmid

20-abx977087
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat RAB3B shRNA Plasmid

20-abx986689
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RAB3B Antibody, HRP conjugated

1-CSB-PA019195LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB3B. Recognizes RAB3B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB3B Antibody, FITC conjugated

1-CSB-PA019195LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB3B. Recognizes RAB3B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB3B Antibody, Biotin conjugated

1-CSB-PA019195LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB3B. Recognizes RAB3B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human RAB3B shRNA Plasmid

20-abx953955
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RAB3B Recombinant Protein (Human)

RP025504 100 ug Ask for price

RAB3B Recombinant Protein (Mouse)

RP166307 100 ug Ask for price

RAB3B Recombinant Protein (Rat)

RP223337 100 ug Ask for price

Monoclonal RAB3B Antibody, Clone: 1543CT354.60.92

AMM02529G 0.1ml
EUR 484.00
Description: A Monoclonal antibody against Human RAB3B. The antibodies are raised in Mouse and are from clone 1543CT354.60.92. This antibody is applicable in FC, IHC-P, WB, E

RAB3B Polyclonal Antibody, HRP Conjugated

A63263 100 µg
EUR 570.55
Description: fast delivery possible

RAB3B Polyclonal Antibody, FITC Conjugated

A63264 100 µg
EUR 570.55
Description: reagents widely cited

RAB3B Polyclonal Antibody, Biotin Conjugated

A63265 100 µg
EUR 570.55
Description: Ask the seller for details

Rab3b ORF Vector (Rat) (pORF)

ORF074447 1.0 ug DNA
EUR 506.00

RAB3B ORF Vector (Human) (pORF)

ORF008502 1.0 ug DNA
EUR 95.00

Rab3b ORF Vector (Mouse) (pORF)

ORF055437 1.0 ug DNA
EUR 506.00

RAB3B ELISA Kit (Human) (OKCA01480)

OKCA01480 96 Wells
EUR 846.00
Description: Description of target: Protein transport. Probably involved in vesicular traffic.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.9 pg/mL

RAB3B ELISA Kit (Human) (OKEH08545)

OKEH08545 96 Wells
EUR 896.00
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.118ng/mL

Rab3B, Member Ras Oncogene Family Antibody

20-abx114990
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB3B, Member RAS Oncogene Family Protein

20-abx261461
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Rab3b sgRNA CRISPR Lentivector set (Rat)

K7111501 3 x 1.0 ug
EUR 339.00

Rab3b sgRNA CRISPR Lentivector set (Mouse)

K4584901 3 x 1.0 ug
EUR 339.00

RAB3B sgRNA CRISPR Lentivector set (Human)

K1768501 3 x 1.0 ug
EUR 339.00

Recombinant Human RAB3B, Member RAS Oncogene Family

7-05983 5µg Ask for price

Recombinant Human RAB3B, Member RAS Oncogene Family

7-05984 20µg Ask for price

Recombinant Human RAB3B, Member RAS Oncogene Family

7-05985 1mg Ask for price

Monoclonal RAB3B Antibody (monoclonal) (M01), Clone: 3F12

AMM03976G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human RAB3B (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3F12. This antibody is applicable in WB, IHC and IF, E

Rab3b sgRNA CRISPR Lentivector (Rat) (Target 1)

K7111502 1.0 ug DNA
EUR 154.00

Rab3b sgRNA CRISPR Lentivector (Rat) (Target 2)

K7111503 1.0 ug DNA
EUR 154.00

Rab3b sgRNA CRISPR Lentivector (Rat) (Target 3)

K7111504 1.0 ug DNA
EUR 154.00

Rab3b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4584902 1.0 ug DNA
EUR 154.00

Rab3b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4584903 1.0 ug DNA
EUR 154.00

Rab3b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4584904 1.0 ug DNA
EUR 154.00

RAB3B sgRNA CRISPR Lentivector (Human) (Target 1)

K1768502 1.0 ug DNA
EUR 154.00

RAB3B sgRNA CRISPR Lentivector (Human) (Target 2)

K1768503 1.0 ug DNA
EUR 154.00

RAB3B sgRNA CRISPR Lentivector (Human) (Target 3)

K1768504 1.0 ug DNA
EUR 154.00

RAB3B Protein Vector (Rat) (pPB-C-His)

PV297786 500 ng
EUR 603.00

RAB3B Protein Vector (Rat) (pPB-N-His)

PV297787 500 ng
EUR 603.00

RAB3B Protein Vector (Rat) (pPM-C-HA)

PV297788 500 ng
EUR 603.00

RAB3B Protein Vector (Rat) (pPM-C-His)

PV297789 500 ng
EUR 603.00

RAB3B Protein Vector (Human) (pPB-C-His)

PV034005 500 ng
EUR 329.00

RAB3B Protein Vector (Human) (pPB-N-His)

PV034006 500 ng
EUR 329.00

RAB3B Protein Vector (Human) (pPM-C-HA)

PV034007 500 ng
EUR 329.00

RAB3B Protein Vector (Human) (pPM-C-His)

PV034008 500 ng
EUR 329.00

RAB3B Protein Vector (Mouse) (pPB-C-His)

PV221746 500 ng
EUR 603.00

RAB3B Protein Vector (Mouse) (pPB-N-His)

PV221747 500 ng
EUR 603.00

RAB3B Protein Vector (Mouse) (pPM-C-HA)

PV221748 500 ng
EUR 603.00

RAB3B Protein Vector (Mouse) (pPM-C-His)

PV221749 500 ng
EUR 603.00

Recombinant Human RAB3B Protein, His, E.coli-1mg

QP13242-1mg 1mg
EUR 2757.00

Recombinant Human RAB3B Protein, His, E.coli-20ug

QP13242-20ug 20ug
EUR 201.00

Recombinant Human RAB3B Protein, His, E.coli-5ug

QP13242-5ug 5ug
EUR 155.00

Rab3b 3'UTR Luciferase Stable Cell Line

TU117422 1.0 ml Ask for price

Rab3b 3'UTR GFP Stable Cell Line

TU167422 1.0 ml Ask for price

Rab3b 3'UTR Luciferase Stable Cell Line

TU217204 1.0 ml Ask for price

Rab3b 3'UTR GFP Stable Cell Line

TU267204 1.0 ml Ask for price

RAB3B 3'UTR GFP Stable Cell Line

TU069330 1.0 ml
EUR 4617.00

RAB3B 3'UTR Luciferase Stable Cell Line

TU019330 1.0 ml
EUR 4617.00

RAB3B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV626695 1.0 ug DNA
EUR 514.00

RAB3B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV626699 1.0 ug DNA
EUR 514.00

RAB3B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV626700 1.0 ug DNA
EUR 514.00

RAB3B, Member RAS Oncogene Family Human Recombinant Protein

PROTP20337 Regular: 20ug
EUR 317.00
Description: RAB3B Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 239 amino acids (1-219) and having a molecular mass of 26.9 kDa.;The RAB3B is fused to a 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Human RAB3B/ Ras-related protein Rab-3B ELISA Kit

E2945Hu 1 Kit
EUR 605.00

Mouse Ras- related protein Rab- 3B, Rab3b ELISA KIT

ELI-30464m 96 Tests
EUR 865.00