RAB3C antibody

22215-100ul 100ul
EUR 390

RAB3c Antibody

31148-100ul 100ul
EUR 252

RAB3c Antibody

31148-50ul 50ul
EUR 187

RAB3C antibody

70R-13211 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RAB3C antibody

RAB3C antibody

70R-19710 50 ul
EUR 435
Description: Rabbit polyclonal RAB3C antibody

RAB3C Antibody

1-CSB-PA846609HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB3C. Recognizes RAB3C from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

RAB3C Antibody

1-CSB-PA643796
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB3C. Recognizes RAB3C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:500-1:2000, IHC:1:25-1:100

RAB3C Antibody

DF12716 200ul
EUR 304
Description: RAB3C Antibody detects endogenous levels of RAB3C.

RAB3C Antibody

1-CSB-PA019196GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB3C. Recognizes RAB3C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RAB3C siRNA

20-abx904426
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB3C siRNA

20-abx930666
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB3C siRNA

20-abx930667
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3c) Antibody

20-abx007371
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Rab3C, Member Ras Oncogene Family (RAB3C) Antibody

20-abx114991
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody

abx122430-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody

abx034865-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody

abx034865-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody

20-abx241111
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody

20-abx318643
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody

abx237027-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody (HRP)

20-abx309816
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody (FITC)

20-abx309817
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody (Biotin)

20-abx309818
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB3C Blocking Peptide

DF12716-BP 1mg
EUR 195

RAB3c Conjugated Antibody

C31148 100ul
EUR 397

RAB3C-specific Antibody

abx237028-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

RAB3C cloning plasmid

CSB-CL846609HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 684
  • Sequence: atgagacacgaagcgcccatgcagatggcctctgcccaagatgccaggtacggccagaaagactcctctgatcagaactttgactacatgttcaaattactcatcatcggcaatagcagtgtggggaaaacatcttttctattccgttatgcagatgactcctttacatctgcatt
  • Show more
Description: A cloning plasmid for the RAB3C gene.

RAB3C Polyclonal Antibody

A56779 100 µg
EUR 570.55
Description: fast delivery possible

RAB3C Rabbit pAb

A2823-100ul 100 ul
EUR 308

RAB3C Rabbit pAb

A2823-200ul 200 ul
EUR 459

RAB3C Rabbit pAb

A2823-20ul 20 ul Ask for price

RAB3C Rabbit pAb

A2823-50ul 50 ul Ask for price

anti- RAB3C antibody

FNab07027 100µg
EUR 548.75
  • Immunogen: RAB3C, member RAS oncogene family
  • Uniprot ID: Q96E17
  • Gene ID: 115827
  • Research Area: Signal Transduction
Description: Antibody raised against RAB3C

Anti-Rab3C Antibody

PA2279 100ug/vial
EUR 294

Anti-RAB3C antibody

PAab07027 100 ug
EUR 386

Anti-RAB3C antibody

STJ25261 100 µl
EUR 277
Description: This gene is a member of the RAS oncogene family and encodes a small GTPase. Other similar small GTPases are known to be involved in vesicle trafficking, and the encoded protein was shown to play a role in recycling phagocytosed MHC class 1 complexes to the cell surface. Two transcript variants encoding different isoforms have been found for this gene.

Anti-Rab3C (1H4)

YF-MA19759 100 ug
EUR 363
Description: Mouse monoclonal to Rab3C

RAB3C Antibody, HRP conjugated

1-CSB-PA846609HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB3C. Recognizes RAB3C from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB3C Antibody, FITC conjugated

1-CSB-PA846609HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB3C. Recognizes RAB3C from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB3C Antibody, Biotin conjugated

1-CSB-PA846609HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB3C. Recognizes RAB3C from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal RAB3C Antibody (Center)

APR04592G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB3C (Center). This antibody is tested and proven to work in the following applications:

RAB3C ELISA KIT|Human

EF002243 96 Tests
EUR 689

Rat RAB3C shRNA Plasmid

20-abx987664
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RAB3C shRNA Plasmid

20-abx976084
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAB3C shRNA Plasmid

20-abx964470
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

anti- RAB3C-specific antibody

FNab07028 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IF: 1:10-1:100
  • Immunogen: RAB3C, member RAS oncogene family
  • Uniprot ID: Q96E17
  • Research Area: Signal Transduction
Description: Antibody raised against RAB3C-specific

Anti-RAB3C-specific antibody

PAab07028 100 ug
EUR 355

RAB3C Recombinant Protein (Human)

RP025507 100 ug Ask for price

RAB3C Recombinant Protein (Mouse)

RP166310 100 ug Ask for price

RAB3C Recombinant Protein (Rat)

RP223340 100 ug Ask for price

RAB3C Polyclonal Antibody, HRP Conjugated

A56780 100 µg
EUR 570.55
Description: reagents widely cited

RAB3C Polyclonal Antibody, FITC Conjugated

A56781 100 µg
EUR 570.55
Description: Ask the seller for details

RAB3C Polyclonal Antibody, Biotin Conjugated

A56782 100 µg
EUR 570.55
Description: The best epigenetics products

Rab3c ORF Vector (Rat) (pORF)

ORF074448 1.0 ug DNA
EUR 506

RAB3C ORF Vector (Human) (pORF)

ORF008503 1.0 ug DNA
EUR 95

Rab3c ORF Vector (Mouse) (pORF)

ORF055438 1.0 ug DNA
EUR 506

pECMV-Rab3c-m-FLAG Plasmid

PVT14966 2 ug
EUR 325

RAB3C ELISA Kit (Human) (OKEH08546)

OKEH08546 96 Wells
EUR 896
Description: Description of target: This gene is a member of the RAS oncogene family and encodes a small GTPase. Other similar small GTPases are known to be involved in vesicle trafficking, and the encoded protein was shown to play a role in recycling phagocytosed MHC class 1 complexes to the cell surface. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.117ng/mL

Polyclonal RAB3C antibody - C-terminal region

APR01585G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB3C - C-terminal region. This antibody is tested and proven to work in the following applications:

Rab3c sgRNA CRISPR Lentivector set (Rat)

K7011401 3 x 1.0 ug
EUR 339

Rab3c sgRNA CRISPR Lentivector set (Mouse)

K4027401 3 x 1.0 ug
EUR 339

RAB3C sgRNA CRISPR Lentivector set (Human)

K1768601 3 x 1.0 ug
EUR 339

Human Ras-related protein Rab-3C (RAB3C)

1-CSB-EP846609HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 42 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-3C(RAB3C) expressed in E.coli

Rab3c sgRNA CRISPR Lentivector (Rat) (Target 1)

K7011402 1.0 ug DNA
EUR 154

Rab3c sgRNA CRISPR Lentivector (Rat) (Target 2)

K7011403 1.0 ug DNA
EUR 154

Rab3c sgRNA CRISPR Lentivector (Rat) (Target 3)

K7011404 1.0 ug DNA
EUR 154

Rab3c sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4027402 1.0 ug DNA
EUR 154

Rab3c sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4027403 1.0 ug DNA
EUR 154

Rab3c sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4027404 1.0 ug DNA
EUR 154

RAB3C sgRNA CRISPR Lentivector (Human) (Target 1)

K1768602 1.0 ug DNA
EUR 154

RAB3C sgRNA CRISPR Lentivector (Human) (Target 2)

K1768603 1.0 ug DNA
EUR 154

RAB3C sgRNA CRISPR Lentivector (Human) (Target 3)

K1768604 1.0 ug DNA
EUR 154

RAB3C Protein Vector (Rat) (pPB-C-His)

PV297790 500 ng
EUR 603

RAB3C Protein Vector (Rat) (pPB-N-His)

PV297791 500 ng
EUR 603

RAB3C Protein Vector (Rat) (pPM-C-HA)

PV297792 500 ng
EUR 603

RAB3C Protein Vector (Rat) (pPM-C-His)

PV297793 500 ng
EUR 603

RAB3C Protein Vector (Human) (pPB-C-His)

PV034009 500 ng
EUR 329

RAB3C Protein Vector (Human) (pPB-N-His)

PV034010 500 ng
EUR 329

RAB3C Protein Vector (Human) (pPM-C-HA)

PV034011 500 ng
EUR 329

RAB3C Protein Vector (Human) (pPM-C-His)

PV034012 500 ng
EUR 329

RAB3C Protein Vector (Mouse) (pPB-C-His)

PV221750 500 ng
EUR 603

RAB3C Protein Vector (Mouse) (pPB-N-His)

PV221751 500 ng
EUR 603

RAB3C Protein Vector (Mouse) (pPM-C-HA)

PV221752 500 ng
EUR 603

RAB3C Protein Vector (Mouse) (pPM-C-His)

PV221753 500 ng
EUR 603

Rab3c 3'UTR Luciferase Stable Cell Line

TU117423 1.0 ml Ask for price