RAB3C antibody
22215-100ul	SAB	100ul	EUR 390.00

RAB3c Antibody
31148-100ul	SAB	100ul	EUR 252.00

RAB3c Antibody
31148-50ul	SAB	50ul	EUR 187.00

RAB3C antibody
70R-13211	Fitzgerald	100 ul	EUR 457.00
Description: Affinity purified Rabbit polyclonal RAB3C antibody

RAB3C antibody
70R-19710	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal RAB3C antibody

RAB3C Antibody
1-CSB-PA846609HA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB3C. Recognizes RAB3C from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

RAB3C Antibody
1-CSB-PA643796	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB3C. Recognizes RAB3C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:500-1:2000, IHC:1:25-1:100

RAB3C Antibody
DF12716	Affbiotech	200ul	EUR 304.00
Description: RAB3C Antibody detects endogenous levels of RAB3C.

RAB3C Antibody
1-CSB-PA019196GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB3C. Recognizes RAB3C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RAB3C siRNA
20-abx904426	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RAB3C siRNA
20-abx930666	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RAB3C siRNA
20-abx930667	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3c) Antibody
20-abx007371	Abbexa	EUR 411.00 EUR 592.00	0 1
Shipped within 5-10 working days.

Rab3C, Member Ras Oncogene Family (RAB3C) Antibody
20-abx114991	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody
abx122430-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody
abx034865-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody
abx034865-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody
20-abx241111	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody
20-abx318643	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody
abx237027-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody (HRP)
20-abx309816	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody (FITC)
20-abx309817	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

RAB3C, Member RAS Oncogene Family (RAB3C) Antibody (Biotin)
20-abx309818	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

RAB3C Blocking Peptide
DF12716-BP	Affbiotech	1mg	EUR 195.00

RAB3c Conjugated Antibody
C31148	SAB	100ul	EUR 397.00

RAB3C-specific Antibody
abx237028-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

RAB3C cloning plasmid
CSB-CL846609HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 684 Sequence: atgagacacgaagcgcccatgcagatggcctctgcccaagatgccaggtacggccagaaagactcctctgatcagaactttgactacatgttcaaattactcatcatcggcaatagcagtgtggggaaaacatcttttctattccgttatgcagatgactcctttacatctgcatt Show more
Description: A cloning plasmid for the RAB3C gene.

RAB3C Polyclonal Antibody
A56779	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

RAB3C Rabbit pAb
A2823-100ul	Abclonal	100 ul	EUR 308.00

RAB3C Rabbit pAb
A2823-200ul	Abclonal	200 ul	EUR 459.00

RAB3C Rabbit pAb
A2823-20ul	Abclonal	20 ul	Ask for price

RAB3C Rabbit pAb
A2823-50ul	Abclonal	50 ul	Ask for price

anti- RAB3C antibody
FNab07027	FN Test	100µg	EUR 548.75
Immunogen: RAB3C, member RAS oncogene family Uniprot ID: Q96E17 Gene ID: 115827 Research Area: Signal Transduction
Description: Antibody raised against RAB3C

Anti-Rab3C Antibody
PA2279	BosterBio	100ug/vial	EUR 294.00

Anti-RAB3C antibody
PAab07027	Lifescience Market	100 ug	EUR 386.00

Anti-RAB3C antibody
STJ25261	St John's Laboratory	100 µl	EUR 277.00
Description: This gene is a member of the RAS oncogene family and encodes a small GTPase. Other similar small GTPases are known to be involved in vesicle trafficking, and the encoded protein was shown to play a role in recycling phagocytosed MHC class 1 complexes to the cell surface. Two transcript variants encoding different isoforms have been found for this gene.

Anti-Rab3C (1H4)
YF-MA19759	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to Rab3C

RAB3C Antibody, HRP conjugated
1-CSB-PA846609HB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB3C. Recognizes RAB3C from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB3C Antibody, FITC conjugated
1-CSB-PA846609HC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB3C. Recognizes RAB3C from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB3C Antibody, Biotin conjugated
1-CSB-PA846609HD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB3C. Recognizes RAB3C from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal RAB3C Antibody (Center)
APR04592G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB3C (Center). This antibody is tested and proven to work in the following applications:

RAB3C ELISA KIT|Human
EF002243	Lifescience Market	96 Tests	EUR 689.00

Rat RAB3C shRNA Plasmid
20-abx987664	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse RAB3C shRNA Plasmid
20-abx976084	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human RAB3C shRNA Plasmid
20-abx964470	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

anti- RAB3C-specific antibody
FNab07028	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IF: 1:10-1:100 Immunogen: RAB3C, member RAS oncogene family Uniprot ID: Q96E17 Research Area: Signal Transduction
Description: Antibody raised against RAB3C-specific

Anti-RAB3C-specific antibody
PAab07028	Lifescience Market	100 ug	EUR 355.00

RAB3C Recombinant Protein (Human)
RP025507	ABM	100 ug	Ask for price

RAB3C Recombinant Protein (Mouse)
RP166310	ABM	100 ug	Ask for price

RAB3C Recombinant Protein (Rat)
RP223340	ABM	100 ug	Ask for price

RAB3C Polyclonal Antibody, HRP Conjugated
A56780	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

RAB3C Polyclonal Antibody, FITC Conjugated
A56781	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

RAB3C Polyclonal Antibody, Biotin Conjugated
A56782	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Rab3c ORF Vector (Rat) (pORF)
ORF074448	ABM	1.0 ug DNA	EUR 506.00

RAB3C ORF Vector (Human) (pORF)
ORF008503	ABM	1.0 ug DNA	EUR 95.00

Rab3c ORF Vector (Mouse) (pORF)
ORF055438	ABM	1.0 ug DNA	EUR 506.00

pECMV-Rab3c-m-FLAG Plasmid
PVT14966	Lifescience Market	2 ug	EUR 325.00

RAB3C ELISA Kit (Human) (OKEH08546)
OKEH08546	Aviva Systems Biology	96 Wells	EUR 896.00
Description: Description of target: This gene is a member of the RAS oncogene family and encodes a small GTPase. Other similar small GTPases are known to be involved in vesicle trafficking, and the encoded protein was shown to play a role in recycling phagocytosed MHC class 1 complexes to the cell surface. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.117ng/mL

Polyclonal RAB3C antibody - C-terminal region
APR01585G	Leading Biology	0.05mg	EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB3C - C-terminal region. This antibody is tested and proven to work in the following applications:

Rab3c sgRNA CRISPR Lentivector set (Rat)
K7011401	ABM	3 x 1.0 ug	EUR 339.00

Rab3c sgRNA CRISPR Lentivector set (Mouse)
K4027401	ABM	3 x 1.0 ug	EUR 339.00

RAB3C sgRNA CRISPR Lentivector set (Human)
K1768601	ABM	3 x 1.0 ug	EUR 339.00

Human Ras-related protein Rab-3C (RAB3C)
1-CSB-EP846609HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	0 1 2 3 4 5
MW: 42 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-3C(RAB3C) expressed in E.coli

Rab3c sgRNA CRISPR Lentivector (Rat) (Target 1)
K7011402	ABM	1.0 ug DNA	EUR 154.00

Rab3c sgRNA CRISPR Lentivector (Rat) (Target 2)
K7011403	ABM	1.0 ug DNA	EUR 154.00

Rab3c sgRNA CRISPR Lentivector (Rat) (Target 3)
K7011404	ABM	1.0 ug DNA	EUR 154.00

Rab3c sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4027402	ABM	1.0 ug DNA	EUR 154.00

Rab3c sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4027403	ABM	1.0 ug DNA	EUR 154.00

Rab3c sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4027404	ABM	1.0 ug DNA	EUR 154.00

RAB3C sgRNA CRISPR Lentivector (Human) (Target 1)
K1768602	ABM	1.0 ug DNA	EUR 154.00

RAB3C sgRNA CRISPR Lentivector (Human) (Target 2)
K1768603	ABM	1.0 ug DNA	EUR 154.00

RAB3C sgRNA CRISPR Lentivector (Human) (Target 3)
K1768604	ABM	1.0 ug DNA	EUR 154.00

RAB3C Protein Vector (Rat) (pPB-C-His)
PV297790	ABM	500 ng	EUR 603.00

RAB3C Protein Vector (Rat) (pPB-N-His)
PV297791	ABM	500 ng	EUR 603.00

RAB3C Protein Vector (Rat) (pPM-C-HA)
PV297792	ABM	500 ng	EUR 603.00

RAB3C Protein Vector (Rat) (pPM-C-His)
PV297793	ABM	500 ng	EUR 603.00

RAB3C Protein Vector (Human) (pPB-C-His)
PV034009	ABM	500 ng	EUR 329.00

RAB3C Protein Vector (Human) (pPB-N-His)
PV034010	ABM	500 ng	EUR 329.00

RAB3C Protein Vector (Human) (pPM-C-HA)
PV034011	ABM	500 ng	EUR 329.00

RAB3C Protein Vector (Human) (pPM-C-His)
PV034012	ABM	500 ng	EUR 329.00

RAB3C Protein Vector (Mouse) (pPB-C-His)
PV221750	ABM	500 ng	EUR 603.00

RAB3C Protein Vector (Mouse) (pPB-N-His)
PV221751	ABM	500 ng	EUR 603.00

RAB3C Protein Vector (Mouse) (pPM-C-HA)
PV221752	ABM	500 ng	EUR 603.00

RAB3C Protein Vector (Mouse) (pPM-C-His)
PV221753	ABM	500 ng	EUR 603.00

Rab3c 3'UTR Luciferase Stable Cell Line
TU117423	ABM	1.0 ml	Ask for price