RAB5B

RAB5B Antibody
46191-100ul	SAB	100ul	EUR 252.00

RAB5B Antibody
46191-50ul	SAB	50ul	EUR 187.00

RAB5B Antibody
DF9834	Affbiotech	200ul	EUR 304.00
Description: RAB5B Antibody detects endogenous levels of total RAB5B.

RAB5B antibody
70R-5873	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal RAB5B antibody raised against the N terminal of RAB5B

RAB5B Antibody
1-CSB-PA019214ESR1HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB5B. Recognizes RAB5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAB5B Antibody
1-CSB-PA019214ESR2HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB5B. Recognizes RAB5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAB5B Antibody
1-CSB-PA019214GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAB5B. Recognizes RAB5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RAB5B siRNA
20-abx930695	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RAB5B siRNA
20-abx930696	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RAB5B Antibody
ABD13226	Lifescience Market	100 ug	EUR 438.00

RAB5B Antibody
ABD9834	Lifescience Market	100 ug	EUR 438.00

RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
20-abx006959	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
20-abx218131	Abbexa	EUR 425.00 EUR 342.00	0 1
Shipped within 5-10 working days.

RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
abx145141-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
abx030408-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
abx030408-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
abx237040-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
20-abx321877	Abbexa	EUR 439.00 EUR 328.00	0 1
Shipped within 5-10 working days.

RAB5B, Member RAS Oncogene Family (RAB5B) Antibody
20-abx321878	Abbexa	EUR 439.00 EUR 328.00	0 1
Shipped within 5-10 working days.

RAB5B Blocking Peptide
33R-6565	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB5B antibody, catalog no. 70R-5873

RAB5B Blocking Peptide
DF9834-BP	Affbiotech	1mg	EUR 195.00

RAB5B Conjugated Antibody
C46191	SAB	100ul	EUR 397.00

RAB5B cloning plasmid
CSB-CL019214HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 648 Sequence: ATGACTAGCAGAAGCACAGCTAGGCCCAATGGGCAACCCCAGGCCAGCAAAATTTGCCAGTTCAAATTGGTCCTGCTGGGAGAATCTGCAGTGGGAAAGTCAAGCCTGGTATTACGTTTTGTCAAAGGGCAGTTCCATGAGTACCAGGAGAGCACCATTGGAGCGGCCTTCCTCAC Show more
Description: A cloning plasmid for the RAB5B gene.

RAB5B Rabbit pAb
A7447-100ul	Abclonal	100 ul	EUR 308.00

RAB5B Rabbit pAb
A7447-200ul	Abclonal	200 ul	EUR 459.00

RAB5B Rabbit pAb
A7447-20ul	Abclonal	20 ul	EUR 183.00

RAB5B Rabbit pAb
A7447-50ul	Abclonal	50 ul	EUR 223.00

RAB5B Polyclonal Antibody
ABP60069-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170 Applications tips:
Description: A polyclonal antibody for detection of RAB5B from Human, Mouse. This RAB5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170

RAB5B Polyclonal Antibody
ABP60069-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170 Applications tips:
Description: A polyclonal antibody for detection of RAB5B from Human, Mouse. This RAB5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170

RAB5B Polyclonal Antibody
ABP60069-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170 Applications tips:
Description: A polyclonal antibody for detection of RAB5B from Human, Mouse. This RAB5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB5B protein at amino acid sequence of 90-170

anti- RAB5B antibody
FNab07040	FN Test	100µg	EUR 505.25
Immunogen: RAB5B, member RAS oncogene family Uniprot ID: P61020 Gene ID: 5869 Research Area: Cardiovascular, Signal Transduction
Description: Antibody raised against RAB5B

RAB5B Polyclonal Antibody
ES10131-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against RAB5B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB5B Polyclonal Antibody
ES10131-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against RAB5B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-RAB5B antibody
PAab07040	Lifescience Market	100 ug	EUR 355.00

pCMV-SPORT6-RAB5B
PVT14173	Lifescience Market	2 ug	EUR 495.00

Anti-Rab5b antibody
STJ140061	St John's Laboratory	200 µg	EUR 231.00
Description: Goat polyclonal antibody to mouse Rab5b. Rab5b belongs to the small GTPase superfamily, Rab family. Rab5b is an Early Endosome Marker and functions as a key regulator of vesicular trafficking during early endocytosis.

Anti-RAB5B antibody
STJ29583	St John's Laboratory	100 µl	EUR 277.00

Anti-RAB5B antibody
STJ191289	St John's Laboratory	200 µl	EUR 197.00
Description: Unconjugated Rabbit polyclonal to RAB5B

RAB5B protein (His tag)
80R-1605	Fitzgerald	100 ug	EUR 305.00
Description: Purified recombinant Human RAB5B protein

RAB5B ELISA KIT|Human
EF002255	Lifescience Market	96 Tests	EUR 689.00

Mouse RAB5B shRNA Plasmid
20-abx972349	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Polyclonal RAB5B Antibody (Center)
APR13055G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB5B (Center). This antibody is tested and proven to work in the following applications:

Human RAB5B shRNA Plasmid
20-abx953959	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

RAB5B Recombinant Protein (Human)
RP042685	ABM	100 ug	Ask for price

RAB5B Recombinant Protein (Mouse)
RP166355	ABM	100 ug	Ask for price

RAB5B Recombinant Protein (Rat)
RP223373	ABM	100 ug	Ask for price

Monoclonal RAB5B Antibody, Clone: 1615CT668.28.45
APR13054G	Leading Biology	0.1ml	EUR 484.00
Description: A Monoclonal antibody against Human RAB5B. The antibodies are raised in Mouse and are from clone 1615CT668.28.45. This antibody is applicable in WB, E

Rab5b ORF Vector (Rat) (pORF)
ORF074459	ABM	1.0 ug DNA	EUR 506.00

RAB5B ORF Vector (Human) (pORF)
ORF014229	ABM	1.0 ug DNA	EUR 354.00

Rab5b ORF Vector (Mouse) (pORF)
ORF055453	ABM	1.0 ug DNA	EUR 506.00

RAB5B ELISA Kit (Human) (OKCA00796)
OKCA00796	Aviva Systems Biology	96 Wells	EUR 833.00
Description: Description of target: Protein transport. Probably involved in vesicular traffic.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.86 pg/mL

Rab5B, Member Ras Oncogene Family Antibody
20-abx114998	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

RAB5B, Member RAS Oncogene Family Protein
20-abx260830	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	0 1 2
Shipped within 5-10 working days.

Rab5b sgRNA CRISPR Lentivector set (Rat)
K6481401	ABM	3 x 1.0 ug	EUR 339.00

RAB5B sgRNA CRISPR Lentivector set (Human)
K1769501	ABM	3 x 1.0 ug	EUR 339.00

Rab5b sgRNA CRISPR Lentivector set (Mouse)
K4745601	ABM	3 x 1.0 ug	EUR 339.00

Recombinant Human RAB5B, Member RAS Oncogene Family
7-05995	CHI Scientific	5µg	Ask for price

Recombinant Human RAB5B, Member RAS Oncogene Family
7-05996	CHI Scientific	20µg	Ask for price

Recombinant Human RAB5B, Member RAS Oncogene Family
7-05997	CHI Scientific	1mg	Ask for price

Human Ras-related protein Rab-5B (RAB5B)
1-CSB-EP019214HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	0 1 2 3 4 5
MW: 50.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-5B(RAB5B) expressed in E.coli

Rab5b sgRNA CRISPR Lentivector (Rat) (Target 1)
K6481402	ABM	1.0 ug DNA	EUR 154.00

Rab5b sgRNA CRISPR Lentivector (Rat) (Target 2)
K6481403	ABM	1.0 ug DNA	EUR 154.00

Rab5b sgRNA CRISPR Lentivector (Rat) (Target 3)
K6481404	ABM	1.0 ug DNA	EUR 154.00

RAB5B sgRNA CRISPR Lentivector (Human) (Target 1)
K1769502	ABM	1.0 ug DNA	EUR 154.00

RAB5B sgRNA CRISPR Lentivector (Human) (Target 2)
K1769503	ABM	1.0 ug DNA	EUR 154.00

RAB5B sgRNA CRISPR Lentivector (Human) (Target 3)
K1769504	ABM	1.0 ug DNA	EUR 154.00

Rab5b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4745602	ABM	1.0 ug DNA	EUR 154.00

Rab5b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4745603	ABM	1.0 ug DNA	EUR 154.00

Rab5b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4745604	ABM	1.0 ug DNA	EUR 154.00

RAB5B Protein Vector (Rat) (pPB-C-His)
PV297834	ABM	500 ng	EUR 603.00

RAB5B Protein Vector (Rat) (pPB-N-His)
PV297835	ABM	500 ng	EUR 603.00

RAB5B Protein Vector (Rat) (pPM-C-HA)
PV297836	ABM	500 ng	EUR 603.00

RAB5B Protein Vector (Rat) (pPM-C-His)
PV297837	ABM	500 ng	EUR 603.00

RAB5B Protein Vector (Human) (pPB-C-His)
PV056913	ABM	500 ng	EUR 481.00

RAB5B Protein Vector (Human) (pPB-N-His)
PV056914	ABM	500 ng	EUR 481.00

RAB5B Protein Vector (Human) (pPM-C-HA)
PV056915	ABM	500 ng	EUR 481.00

RAB5B Protein Vector (Human) (pPM-C-His)
PV056916	ABM	500 ng	EUR 481.00

RAB5B Protein Vector (Mouse) (pPB-C-His)
PV221810	ABM	500 ng	EUR 603.00

RAB5B Protein Vector (Mouse) (pPB-N-His)
PV221811	ABM	500 ng	EUR 603.00

RAB5B Protein Vector (Mouse) (pPM-C-HA)
PV221812	ABM	500 ng	EUR 603.00

RAB5B Protein Vector (Mouse) (pPM-C-His)
PV221813	ABM	500 ng	EUR 603.00

Rab5b 3'UTR Luciferase Stable Cell Line
TU117437	ABM	1.0 ml	Ask for price

Rab5b 3'UTR GFP Stable Cell Line
TU167437	ABM	1.0 ml	Ask for price

Rab5b 3'UTR Luciferase Stable Cell Line
TU217217	ABM	1.0 ml	Ask for price

Rab5b 3'UTR GFP Stable Cell Line
TU267217	ABM	1.0 ml	Ask for price