In den Nachrichten


Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

DLR-RAB7A-Hu-96T 96T
EUR 673.00
  • Should the Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

RDR-RAB7A-Hu-48Tests 48 Tests
EUR 544.00

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

RDR-RAB7A-Hu-96Tests 96 Tests
EUR 756.00

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

RD-RAB7A-Hu-48Tests 48 Tests
EUR 521.00

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

RD-RAB7A-Hu-96Tests 96 Tests
EUR 723.00

Rab7a/ Rat Rab7a ELISA Kit

ELI-44430r 96 Tests
EUR 886.00

RAB7A antibody

38205-100ul 100ul
EUR 252.00

RAB7A Antibody

DF6288 200ul
EUR 304.00
Description: RAB7A Antibody detects endogenous levels of total RAB7A.

RAB7A Antibody

EUR 335.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

RAB7A Antibody

CSB-PA019219KA01HU-100ul 100ul
EUR 389.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

RAB7A Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB7A Antibody

ABD6288 100 ug
EUR 438.00


PVT10344 2 ug
EUR 266.00


YF-PA15488 100 ug
EUR 403.00
Description: Rabbit polyclonal to RAB7A

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

abx117042-100ug 100 ug
EUR 467.00
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

abx122528-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

abx237043-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

  • EUR 495.00
  • EUR 356.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RAB7A Rabbit pAb

A1154-100ul 100 ul
EUR 308.00

RAB7A Rabbit pAb

A1154-200ul 200 ul
EUR 459.00

RAB7A Rabbit pAb

A1154-20ul 20 ul
EUR 183.00

RAB7A Rabbit pAb

A1154-50ul 50 ul
EUR 223.00

RAB7A Rabbit pAb

A12344-100ul 100 ul
EUR 308.00

RAB7A Rabbit pAb

A12344-200ul 200 ul
EUR 459.00

RAB7A Rabbit pAb

A12344-20ul 20 ul Ask for price

RAB7A Rabbit pAb

A12344-50ul 50 ul Ask for price

RAB7A Rabbit pAb

A12784-100ul 100 ul
EUR 308.00

RAB7A Rabbit pAb

A12784-200ul 200 ul
EUR 459.00

RAB7A Rabbit pAb

A12784-20ul 20 ul
EUR 183.00

RAB7A Rabbit pAb

A12784-50ul 50 ul
EUR 223.00

RAB7A Blocking Peptide

DF6288-BP 1mg
EUR 195.00

RAB7A Conjugated Antibody

C38205 100ul
EUR 397.00

RAB7A cloning plasmid

CSB-CL019219HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 696
  • Sequence: atgagtttctcatccaggccagtccccgagatcctgaaaacttcccatttgttgtgttgggaaacaagattgacctcgaaaacagacaagtggccacaaagcgggcacaggcctggtgctacagcaaaaacaacattccctactttgagaccagtgccaaggaggccatcaacgtg
  • Show more
Description: A cloning plasmid for the RAB7A gene.

anti- RAB7A antibody

FNab07043 100µg
EUR 505.25
  • Immunogen: RAB7A, member RAS oncogene family
  • Uniprot ID: P51149
  • Gene ID: 7879
  • Research Area: Signal Transduction
Description: Antibody raised against RAB7A

Anti-RAB7A antibody

PAab07043 100 ug
EUR 355.00

pENTR223- RAB7A- T8G

PVT11507 2 ug
EUR 273.00


PVT13684 2 ug
EUR 391.00


PVT17461 2 ug
EUR 300.00

Anti-RAB7A antibody

STJ25267 100 µl
EUR 277.00
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.

Anti-RAB7A antibody

STJ114224 100 µl
EUR 277.00
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.

Anti-RAB7A antibody

STJ114654 100 µl
EUR 277.00
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.

Anti-Rab7a antibody

STJ140063 150 µg
EUR 231.00
Description: Goat polyclonal antibody to mouse Rab7. Rab7 belongs to the small GTPase superfamily, Rab family. It has been localized to late endosomes, regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. Rab7 also contributes to the maturation of phagosomes (acidification).

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Human RAB7A, Member RAS Oncogene Family (RAB7A) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 0
  • 1
  • 2
  • Please enquire.

Human RAB7A, Member RAS Oncogene Family ELISA Kit (RAB7A)

RK02178 96 Tests
EUR 521.00

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

SEK300Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.50
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

SEK300Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.30
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

SEK300Hu-1x96wellstestplate 1x96-wells test plate
EUR 639.00
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

SEK300Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.50
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 0
  • 1
  • 2
  • Known also as RAB7A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB7
  • Ras-related protein Rab-7a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human RAB7A (RAB7A, Member RAS Oncogene Family)

ELK5152 1 plate of 96 wells
EUR 432.00
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB7A, Member RAS Oncogene Family (RAB7A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of RAB7A, Member RAS Oncogene Family from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

RAB7A protein (His tag)

80R-1636 100 ug
EUR 305.00
Description: Purified recombinant Human RAB7A protein


EF002258 96 Tests
EUR 689.00


ELI-44429d 96 Tests
EUR 928.00

Mouse RAB7A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat RAB7A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RAB7A Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB7A Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB7A Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human RAB7A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Anti-RAB7/RAB7A Antibody

PB9883 100ug/vial
EUR 294.00

RAB7A Recombinant Protein (Human)

RP025543 100 ug Ask for price

RAB7A Recombinant Protein (Rat)

RP223385 100 ug Ask for price

Rab7a ORF Vector (Rat) (pORF)

ORF074463 1.0 ug DNA
EUR 506.00

RAB7A ORF Vector (Human) (pORF)

ORF008515 1.0 ug DNA
EUR 95.00

[One Step] RAB7A antibody Kit

RK05740 50 ul
EUR 240.00

RAB7A ELISA Kit (Human) (OKCD02032)

OKCD02032 96 Wells
EUR 831.00
Description: Description of target: Key regulator in endo-lysosomal trafficking. Governs early-to-late endosomal maturation, microtubule minus-end as well as plus-end directed endosomal migration and positioning, and endosome-lysosome transport through different protein-protein interaction cascades. Plays a central role, not only in endosomal traffic, but also in many other cellular and physiological events, such as growth-factor-mediated cell signaling, nutrient-transportor mediated nutrient uptake, neurotrophin transport in the axons of neurons and lipid metabolism. Also involved in regulation of some specialized endosomal membrane trafficking, such as maturation of melanosomes, pathogen-induced phagosomes (or vacuoles) and autophagosomes. Plays a role in the maturation and acidification of phagosomes that engulf pathogens, such as S.aureus and M.tuberculosis. Plays a role in the fusion of phagosomes with lysosomes. Plays important roles in microbial pathogen infection and survival, as well as in participating in the life cycle of viruses. Microbial pathogens possess survival strategies governed by RAB7A, sometimes by employing RAB7A function (e.g. Salmonella) and sometimes by excluding RAB7A function (e.g. Mycobacterium). In concert with RAC1, plays a role in regulating the formation of RBs (ruffled borders) in osteoclasts. Controls the endosomal trafficking and neurite outgrowth signaling of NTRK1/TRKA.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.113 ng/mL

RAB7A ELISA Kit (Human) (OKEH08041)

OKEH08041 96 Wells
EUR 896.00
Description: Description of target: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.23ng/mL

RAB7A, Member RAS Oncogene Family Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Polyclonal RAB7A / RAB7 Antibody (aa90-140)

AMM07488G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB7A / RAB7 (aa90-140). This antibody is tested and proven to work in the following applications:

Rab7a sgRNA CRISPR Lentivector set (Rat)

K6895601 3 x 1.0 ug
EUR 339.00

RAB7A sgRNA CRISPR Lentivector set (Human)

K1770001 3 x 1.0 ug
EUR 339.00

Recombinant Human RAB7A, Member RAS Oncogene Family

7-06004 5µg Ask for price

Recombinant Human RAB7A, Member RAS Oncogene Family

7-06005 20µg Ask for price

Recombinant Human RAB7A, Member RAS Oncogene Family

7-06006 1mg Ask for price

Rab7a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6895602 1.0 ug DNA
EUR 154.00