RAB7A

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
DLR-RAB7A-Hu-96T	DL Develop	96T	EUR 673.00
Should the Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
RDR-RAB7A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544.00

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
RDR-RAB7A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756.00

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
RD-RAB7A-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521.00

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
RD-RAB7A-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723.00

Rab7a/ Rat Rab7a ELISA Kit
ELI-44430r	Lifescience Market	96 Tests	EUR 886.00

RAB7A antibody
38205-100ul	SAB	100ul	EUR 252.00

RAB7A Antibody
DF6288	Affbiotech	200ul	EUR 304.00
Description: RAB7A Antibody detects endogenous levels of total RAB7A.

RAB7A Antibody
CSB-PA019219KA01HU-	Cusabio		EUR 335.00
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

RAB7A Antibody
CSB-PA019219KA01HU-100ul	Cusabio	100ul	EUR 389.00
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

RAB7A Antibody
1-CSB-PA019219LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

RAB7A siRNA
20-abx904434	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RAB7A siRNA
20-abx930704	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RAB7A siRNA
20-abx930705	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RAB7A Antibody
ABD6288	Lifescience Market	100 ug	EUR 438.00

EGFP- Rab7A
PVT10344	Lifescience Market	2 ug	EUR 266.00

anti-RAB7A
YF-PA15488	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to RAB7A

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
abx117042-100ug	Abbexa	100 ug	EUR 467.00
Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
20-abx127026	Abbexa	EUR 411.00 EUR 592.00	0 1
Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
abx122528-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
abx237043-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
20-abx302116	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
20-abx000788	Abbexa	EUR 495.00 EUR 356.00	0 1
Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
20-abx001068	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (HRP)
20-abx314287	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (FITC)
20-abx314288	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (Biotin)
20-abx314289	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

RAB7A Rabbit pAb
A1154-100ul	Abclonal	100 ul	EUR 308.00

RAB7A Rabbit pAb
A1154-200ul	Abclonal	200 ul	EUR 459.00

RAB7A Rabbit pAb
A1154-20ul	Abclonal	20 ul	EUR 183.00

RAB7A Rabbit pAb
A1154-50ul	Abclonal	50 ul	EUR 223.00

RAB7A Rabbit pAb
A12344-100ul	Abclonal	100 ul	EUR 308.00

RAB7A Rabbit pAb
A12344-200ul	Abclonal	200 ul	EUR 459.00

RAB7A Rabbit pAb
A12344-20ul	Abclonal	20 ul	Ask for price

RAB7A Rabbit pAb
A12344-50ul	Abclonal	50 ul	Ask for price

RAB7A Rabbit pAb
A12784-100ul	Abclonal	100 ul	EUR 308.00

RAB7A Rabbit pAb
A12784-200ul	Abclonal	200 ul	EUR 459.00

RAB7A Rabbit pAb
A12784-20ul	Abclonal	20 ul	EUR 183.00

RAB7A Rabbit pAb
A12784-50ul	Abclonal	50 ul	EUR 223.00

RAB7A Blocking Peptide
DF6288-BP	Affbiotech	1mg	EUR 195.00

RAB7A Conjugated Antibody
C38205	SAB	100ul	EUR 397.00

RAB7A cloning plasmid
CSB-CL019219HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 696 Sequence: atgagtttctcatccaggccagtccccgagatcctgaaaacttcccatttgttgtgttgggaaacaagattgacctcgaaaacagacaagtggccacaaagcgggcacaggcctggtgctacagcaaaaacaacattccctactttgagaccagtgccaaggaggccatcaacgtg Show more
Description: A cloning plasmid for the RAB7A gene.

anti- RAB7A antibody
FNab07043	FN Test	100µg	EUR 505.25
Immunogen: RAB7A, member RAS oncogene family Uniprot ID: P51149 Gene ID: 7879 Research Area: Signal Transduction
Description: Antibody raised against RAB7A

Anti-RAB7A antibody
PAab07043	Lifescience Market	100 ug	EUR 355.00

pENTR223- RAB7A- T8G
PVT11507	Lifescience Market	2 ug	EUR 273.00

pCMV-SPORT6-RAB7A
PVT13684	Lifescience Market	2 ug	EUR 391.00

EGFP-Rab7A Q67L
PVT17461	Lifescience Market	2 ug	EUR 300.00

Anti-RAB7A antibody
STJ25267	St John's Laboratory	100 µl	EUR 277.00
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.

Anti-RAB7A antibody
STJ114224	St John's Laboratory	100 µl	EUR 277.00
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.

Anti-RAB7A antibody
STJ114654	St John's Laboratory	100 µl	EUR 277.00
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.

Anti-Rab7a antibody
STJ140063	St John's Laboratory	150 µg	EUR 231.00
Description: Goat polyclonal antibody to mouse Rab7. Rab7 belongs to the small GTPase superfamily, Rab family. It has been localized to late endosomes, regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. Rab7 also contributes to the maturation of phagosomes (acidification).

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
20-abx156866	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	0 1 2
Shipped within 5-7 working days.

Human RAB7A, Member RAS Oncogene Family (RAB7A) CLIA Kit
20-abx495849	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	0 1 2
Please enquire.

Human RAB7A, Member RAS Oncogene Family ELISA Kit (RAB7A)
RK02178	Abclonal	96 Tests	EUR 521.00

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
SEK300Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.50
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
SEK300Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.30
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
SEK300Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639.00
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
SEK300Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.50
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
4-SEK300Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	0 1 2
Known also as RAB7A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB7 Ras-related protein Rab-7a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human RAB7A (RAB7A, Member RAS Oncogene Family)
ELK5152	ELK Biotech	1 plate of 96 wells	EUR 432.00
The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB7A, Member RAS Oncogene Family (RAB7A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec Show more
Description: A sandwich ELISA kit for detection of RAB7A, Member RAS Oncogene Family from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

RAB7A protein (His tag)
80R-1636	Fitzgerald	100 ug	EUR 305.00
Description: Purified recombinant Human RAB7A protein

RAB7A ELISA KIT|Human
EF002258	Lifescience Market	96 Tests	EUR 689.00

Canine RAB7A ELISA KIT
ELI-44429d	Lifescience Market	96 Tests	EUR 928.00

Mouse RAB7A shRNA Plasmid
20-abx972354	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat RAB7A shRNA Plasmid
20-abx985507	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

RAB7A Antibody, HRP conjugated
1-CSB-PA019219LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB7A Antibody, FITC conjugated
1-CSB-PA019219LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB7A Antibody, Biotin conjugated
1-CSB-PA019219LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human RAB7A shRNA Plasmid
20-abx955306	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Anti-RAB7/RAB7A Antibody
PB9883	BosterBio	100ug/vial	EUR 294.00

RAB7A Recombinant Protein (Human)
RP025543	ABM	100 ug	Ask for price

RAB7A Recombinant Protein (Rat)
RP223385	ABM	100 ug	Ask for price

Rab7a ORF Vector (Rat) (pORF)
ORF074463	ABM	1.0 ug DNA	EUR 506.00

RAB7A ORF Vector (Human) (pORF)
ORF008515	ABM	1.0 ug DNA	EUR 95.00

[One Step] RAB7A antibody Kit
RK05740	Abclonal	50 ul	EUR 240.00

RAB7A ELISA Kit (Human) (OKCD02032)
OKCD02032	Aviva Systems Biology	96 Wells	EUR 831.00
Description: Description of target: Key regulator in endo-lysosomal trafficking. Governs early-to-late endosomal maturation, microtubule minus-end as well as plus-end directed endosomal migration and positioning, and endosome-lysosome transport through different protein-protein interaction cascades. Plays a central role, not only in endosomal traffic, but also in many other cellular and physiological events, such as growth-factor-mediated cell signaling, nutrient-transportor mediated nutrient uptake, neurotrophin transport in the axons of neurons and lipid metabolism. Also involved in regulation of some specialized endosomal membrane trafficking, such as maturation of melanosomes, pathogen-induced phagosomes (or vacuoles) and autophagosomes. Plays a role in the maturation and acidification of phagosomes that engulf pathogens, such as S.aureus and M.tuberculosis. Plays a role in the fusion of phagosomes with lysosomes. Plays important roles in microbial pathogen infection and survival, as well as in participating in the life cycle of viruses. Microbial pathogens possess survival strategies governed by RAB7A, sometimes by employing RAB7A function (e.g. Salmonella) and sometimes by excluding RAB7A function (e.g. Mycobacterium). In concert with RAC1, plays a role in regulating the formation of RBs (ruffled borders) in osteoclasts. Controls the endosomal trafficking and neurite outgrowth signaling of NTRK1/TRKA.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.113 ng/mL

RAB7A ELISA Kit (Human) (OKEH08041)
OKEH08041	Aviva Systems Biology	96 Wells	EUR 896.00
Description: Description of target: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.23ng/mL

RAB7A, Member RAS Oncogene Family Protein
20-abx260842	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	0 1 2
Shipped within 5-10 working days.

Polyclonal RAB7A / RAB7 Antibody (aa90-140)
AMM07488G	Leading Biology	0.05mg	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB7A / RAB7 (aa90-140). This antibody is tested and proven to work in the following applications:

Rab7a sgRNA CRISPR Lentivector set (Rat)
K6895601	ABM	3 x 1.0 ug	EUR 339.00

RAB7A sgRNA CRISPR Lentivector set (Human)
K1770001	ABM	3 x 1.0 ug	EUR 339.00

Recombinant Human RAB7A, Member RAS Oncogene Family
7-06004	CHI Scientific	5µg	Ask for price

Recombinant Human RAB7A, Member RAS Oncogene Family
7-06005	CHI Scientific	20µg	Ask for price

Recombinant Human RAB7A, Member RAS Oncogene Family
7-06006	CHI Scientific	1mg	Ask for price

Rab7a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6895602	ABM	1.0 ug DNA	EUR 154.00