RENBP siRNA

20-abx904531
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RENBP siRNA

20-abx931261
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RENBP siRNA

20-abx931262
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RENBP

YF-PA24564 50 ul
EUR 334
Description: Mouse polyclonal to RENBP

RENBP cloning plasmid

CSB-CL019562HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1254
  • Sequence: atggagaaagagcgagagactctgcaggcctggaaggagcgcgtggggcaggagctggaccgcgtggtggctttctggatggagcactcccacgaccaggagcacgggggcttcttcacgtgccttggccgcgaggggcgggtgtatgatgacctcaagtatgtgtggctgcagg
  • Show more
Description: A cloning plasmid for the RENBP gene.

RENBP Rabbit pAb

A10012-100ul 100 ul
EUR 308

RENBP Rabbit pAb

A10012-200ul 200 ul
EUR 459

RENBP Rabbit pAb

A10012-20ul 20 ul
EUR 183

RENBP Rabbit pAb

A10012-50ul 50 ul
EUR 223

RENBP Polyclonal Antibody

27252-100ul 100ul
EUR 252

RENBP Polyclonal Antibody

27252-50ul 50ul
EUR 187

Anti-RENBP antibody

STJ112052 100 µl
EUR 277
Description: The gene product inhibits renin activity by forming a dimer with renin, a complex known as high molecular weight renin. The encoded protein contains a leucine zipper domain, which is essential for its dimerization with renin. The gene product can catalyze the interconversion of N-acetylglucosamine to N-acetylmannosamine, indicating that it is a GlcNAc 2-epimerase. Transcript variants utilizing alternative promoters have been described in the literature.

RENBP Polyclonal Conjugated Antibody

C27252 100ul
EUR 397

Rat RENBP shRNA Plasmid

20-abx986693
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Canine RENBP ELISA KIT

ELI-18021d 96 Tests
EUR 928

Human RENBP shRNA Plasmid

20-abx954043
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RENBP shRNA Plasmid

20-abx972430
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RENBP Recombinant Protein (Human)

RP026185 100 ug Ask for price

RENBP Recombinant Protein (Rat)

RP224081 100 ug Ask for price

RENBP Recombinant Protein (Mouse)

RP167597 100 ug Ask for price

RENBP Recombinant Protein (Mouse)

RP167600 100 ug Ask for price

Renin Binding Protein (RENBP) Antibody

20-abx128850
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Renin Binding Protein (RENBP) Antibody

abx122297-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Renin Binding Protein (RENBP) Antibody

20-abx135930
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RENBP ORF Vector (Human) (pORF)

ORF008729 1.0 ug DNA
EUR 95

Renbp ORF Vector (Rat) (pORF)

ORF074695 1.0 ug DNA
EUR 506

Renbp ORF Vector (Mouse) (pORF)

ORF055867 1.0 ug DNA
EUR 506

Renbp ORF Vector (Mouse) (pORF)

ORF055868 1.0 ug DNA
EUR 506

Recombinant Renin Binding Protein (RENBP)

4-RPC764Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P51606
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.0kDa
  • Isoelectric Point: 6.5
Description: Recombinant Human Renin Binding Protein expressed in: E.coli

RENBP ELISA Kit (Pig) (OKCA01804)

OKCA01804 96 Wells
EUR 930
Description: Description of target: Catalyzes the interconversion of N-acetylglucosamine to N-acetylmannosamine. Binds to renin forming a protein complex called high molecular weight (HMW) renin and inhibits renin activity. Involved in the N-glycolylneuraminic acid (Neu5Gc) degradation pathway.;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 15.6 pg/mL

Polyclonal RENBP antibody - C-terminal region

APR01579G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RENBP - C-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal RENBP antibody - N-terminal region

APR01580G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RENBP - N-terminal region. This antibody is tested and proven to work in the following applications:

Human Renin Binding Protein (RENBP) Protein

20-abx167848
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

RENBP sgRNA CRISPR Lentivector set (Human)

K1808701 3 x 1.0 ug
EUR 339

Renbp sgRNA CRISPR Lentivector set (Mouse)

K4463401 3 x 1.0 ug
EUR 339

Renbp sgRNA CRISPR Lentivector set (Rat)

K7013801 3 x 1.0 ug
EUR 339

RENBP sgRNA CRISPR Lentivector (Human) (Target 1)

K1808702 1.0 ug DNA
EUR 154

RENBP sgRNA CRISPR Lentivector (Human) (Target 2)

K1808703 1.0 ug DNA
EUR 154

RENBP sgRNA CRISPR Lentivector (Human) (Target 3)

K1808704 1.0 ug DNA
EUR 154

Renbp sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4463402 1.0 ug DNA
EUR 154

Renbp sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4463403 1.0 ug DNA
EUR 154

Renbp sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4463404 1.0 ug DNA
EUR 154

Renbp sgRNA CRISPR Lentivector (Rat) (Target 1)

K7013802 1.0 ug DNA
EUR 154

Renbp sgRNA CRISPR Lentivector (Rat) (Target 2)

K7013803 1.0 ug DNA
EUR 154

Renbp sgRNA CRISPR Lentivector (Rat) (Target 3)

K7013804 1.0 ug DNA
EUR 154

Renin Binding Protein (RENBP) Polyclonal Antibody (Human)

4-PAC764Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RENBP (Met1~Gln254)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Renin Binding Protein (RENBP)

RENBP Protein Vector (Human) (pPB-C-His)

PV034913 500 ng
EUR 329

RENBP Protein Vector (Human) (pPB-N-His)

PV034914 500 ng
EUR 329

RENBP Protein Vector (Human) (pPM-C-HA)

PV034915 500 ng
EUR 329

RENBP Protein Vector (Human) (pPM-C-His)

PV034916 500 ng
EUR 329

RENBP Protein Vector (Rat) (pPB-C-His)

PV298778 500 ng
EUR 603

RENBP Protein Vector (Rat) (pPB-N-His)

PV298779 500 ng
EUR 603

RENBP Protein Vector (Rat) (pPM-C-HA)

PV298780 500 ng
EUR 603

RENBP Protein Vector (Rat) (pPM-C-His)

PV298781 500 ng
EUR 603

RENBP Protein Vector (Mouse) (pPB-C-His)

PV223466 500 ng
EUR 603

RENBP Protein Vector (Mouse) (pPB-N-His)

PV223467 500 ng
EUR 603

RENBP Protein Vector (Mouse) (pPM-C-HA)

PV223468 500 ng
EUR 603

RENBP Protein Vector (Mouse) (pPM-C-His)

PV223469 500 ng
EUR 603

RENBP Protein Vector (Mouse) (pPB-C-His)

PV223470 500 ng
EUR 603

RENBP Protein Vector (Mouse) (pPB-N-His)

PV223471 500 ng
EUR 603

RENBP Protein Vector (Mouse) (pPM-C-HA)

PV223472 500 ng
EUR 603

RENBP Protein Vector (Mouse) (pPM-C-His)

PV223473 500 ng
EUR 603

Renbp 3'UTR GFP Stable Cell Line

TU167724 1.0 ml Ask for price

RENBP 3'UTR Luciferase Stable Cell Line

TU019751 1.0 ml
EUR 2333

Renbp 3'UTR Luciferase Stable Cell Line

TU117724 1.0 ml Ask for price

RENBP 3'UTR GFP Stable Cell Line

TU069751 1.0 ml
EUR 2333

Renbp 3'UTR GFP Stable Cell Line

TU267474 1.0 ml Ask for price

Renbp 3'UTR Luciferase Stable Cell Line

TU217474 1.0 ml Ask for price

Rat N acylglucosamine 2 epimerase(RENBP) ELISA kit

E02N0571-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat N acylglucosamine 2 epimerase(RENBP) ELISA kit

E02N0571-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat N acylglucosamine 2 epimerase(RENBP) ELISA kit

E02N0571-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse N acylglucosamine 2 epimerase(RENBP) ELISA kit

E03N0571-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse N acylglucosamine 2 epimerase(RENBP) ELISA kit

E03N0571-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse N acylglucosamine 2 epimerase(RENBP) ELISA kit

E03N0571-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit N acylglucosamine 2 epimerase(RENBP) ELISA kit

E04N0571-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit N acylglucosamine 2 epimerase(RENBP) ELISA kit

E04N0571-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit N acylglucosamine 2 epimerase(RENBP) ELISA kit

E04N0571-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acylglucosamine 2 epimerase(RENBP) ELISA kit

E01N0571-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acylglucosamine 2 epimerase(RENBP) ELISA kit

E01N0571-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acylglucosamine 2 epimerase(RENBP) ELISA kit

E01N0571-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog N acylglucosamine 2 epimerase(RENBP) ELISA kit

E08N0571-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog N acylglucosamine 2 epimerase(RENBP) ELISA kit

E08N0571-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog N acylglucosamine 2 epimerase(RENBP) ELISA kit

E08N0571-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey N acylglucosamine 2 epimerase(RENBP) ELISA kit

E09N0571-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey N acylglucosamine 2 epimerase(RENBP) ELISA kit

E09N0571-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.