RENBP

RENBP siRNA
20-abx904531	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RENBP siRNA
20-abx931261	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RENBP siRNA
20-abx931262	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-RENBP
YF-PA24564	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RENBP

RENBP cloning plasmid
CSB-CL019562HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1254 Sequence: atggagaaagagcgagagactctgcaggcctggaaggagcgcgtggggcaggagctggaccgcgtggtggctttctggatggagcactcccacgaccaggagcacgggggcttcttcacgtgccttggccgcgaggggcgggtgtatgatgacctcaagtatgtgtggctgcagg Show more
Description: A cloning plasmid for the RENBP gene.

RENBP Rabbit pAb
A10012-100ul	Abclonal	100 ul	EUR 308

RENBP Rabbit pAb
A10012-200ul	Abclonal	200 ul	EUR 459

RENBP Rabbit pAb
A10012-20ul	Abclonal	20 ul	EUR 183

RENBP Rabbit pAb
A10012-50ul	Abclonal	50 ul	EUR 223

RENBP Polyclonal Antibody
27252-100ul	SAB	100ul	EUR 252

RENBP Polyclonal Antibody
27252-50ul	SAB	50ul	EUR 187

Anti-RENBP antibody
STJ112052	St John's Laboratory	100 µl	EUR 277
Description: The gene product inhibits renin activity by forming a dimer with renin, a complex known as high molecular weight renin. The encoded protein contains a leucine zipper domain, which is essential for its dimerization with renin. The gene product can catalyze the interconversion of N-acetylglucosamine to N-acetylmannosamine, indicating that it is a GlcNAc 2-epimerase. Transcript variants utilizing alternative promoters have been described in the literature.

RENBP Polyclonal Conjugated Antibody
C27252	SAB	100ul	EUR 397

Rat RENBP shRNA Plasmid
20-abx986693	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Canine RENBP ELISA KIT
ELI-18021d	Lifescience Market	96 Tests	EUR 928

Human RENBP shRNA Plasmid
20-abx954043	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RENBP shRNA Plasmid
20-abx972430	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RENBP Recombinant Protein (Human)
RP026185	ABM	100 ug	Ask for price

RENBP Recombinant Protein (Rat)
RP224081	ABM	100 ug	Ask for price

RENBP Recombinant Protein (Mouse)
RP167597	ABM	100 ug	Ask for price

RENBP Recombinant Protein (Mouse)
RP167600	ABM	100 ug	Ask for price

Renin Binding Protein (RENBP) Antibody
20-abx128850	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Renin Binding Protein (RENBP) Antibody
abx122297-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Renin Binding Protein (RENBP) Antibody
20-abx135930	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

RENBP ORF Vector (Human) (pORF)
ORF008729	ABM	1.0 ug DNA	EUR 95

Renbp ORF Vector (Rat) (pORF)
ORF074695	ABM	1.0 ug DNA	EUR 506

Renbp ORF Vector (Mouse) (pORF)
ORF055867	ABM	1.0 ug DNA	EUR 506

Renbp ORF Vector (Mouse) (pORF)
ORF055868	ABM	1.0 ug DNA	EUR 506

Recombinant Renin Binding Protein (RENBP)
4-RPC764Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P51606 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 33.0kDa Isoelectric Point: 6.5
Description: Recombinant Human Renin Binding Protein expressed in: E.coli

RENBP ELISA Kit (Pig) (OKCA01804)
OKCA01804	Aviva Systems Biology	96 Wells	EUR 930
Description: Description of target: Catalyzes the interconversion of N-acetylglucosamine to N-acetylmannosamine. Binds to renin forming a protein complex called high molecular weight (HMW) renin and inhibits renin activity. Involved in the N-glycolylneuraminic acid (Neu5Gc) degradation pathway.;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 15.6 pg/mL

Polyclonal RENBP antibody - C-terminal region
APR01579G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RENBP - C-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal RENBP antibody - N-terminal region
APR01580G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RENBP - N-terminal region. This antibody is tested and proven to work in the following applications:

Human Renin Binding Protein (RENBP) Protein
20-abx167848	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

RENBP sgRNA CRISPR Lentivector set (Human)
K1808701	ABM	3 x 1.0 ug	EUR 339

Renbp sgRNA CRISPR Lentivector set (Mouse)
K4463401	ABM	3 x 1.0 ug	EUR 339

Renbp sgRNA CRISPR Lentivector set (Rat)
K7013801	ABM	3 x 1.0 ug	EUR 339

RENBP sgRNA CRISPR Lentivector (Human) (Target 1)
K1808702	ABM	1.0 ug DNA	EUR 154

RENBP sgRNA CRISPR Lentivector (Human) (Target 2)
K1808703	ABM	1.0 ug DNA	EUR 154

RENBP sgRNA CRISPR Lentivector (Human) (Target 3)
K1808704	ABM	1.0 ug DNA	EUR 154

Renbp sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4463402	ABM	1.0 ug DNA	EUR 154

Renbp sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4463403	ABM	1.0 ug DNA	EUR 154

Renbp sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4463404	ABM	1.0 ug DNA	EUR 154

Renbp sgRNA CRISPR Lentivector (Rat) (Target 1)
K7013802	ABM	1.0 ug DNA	EUR 154

Renbp sgRNA CRISPR Lentivector (Rat) (Target 2)
K7013803	ABM	1.0 ug DNA	EUR 154

Renbp sgRNA CRISPR Lentivector (Rat) (Target 3)
K7013804	ABM	1.0 ug DNA	EUR 154

Renin Binding Protein (RENBP) Polyclonal Antibody (Human)
4-PAC764Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RENBP (Met1~Gln254) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Renin Binding Protein (RENBP)

RENBP Protein Vector (Human) (pPB-C-His)
PV034913	ABM	500 ng	EUR 329

RENBP Protein Vector (Human) (pPB-N-His)
PV034914	ABM	500 ng	EUR 329

RENBP Protein Vector (Human) (pPM-C-HA)
PV034915	ABM	500 ng	EUR 329

RENBP Protein Vector (Human) (pPM-C-His)
PV034916	ABM	500 ng	EUR 329

RENBP Protein Vector (Rat) (pPB-C-His)
PV298778	ABM	500 ng	EUR 603

RENBP Protein Vector (Rat) (pPB-N-His)
PV298779	ABM	500 ng	EUR 603

RENBP Protein Vector (Rat) (pPM-C-HA)
PV298780	ABM	500 ng	EUR 603

RENBP Protein Vector (Rat) (pPM-C-His)
PV298781	ABM	500 ng	EUR 603

RENBP Protein Vector (Mouse) (pPB-C-His)
PV223466	ABM	500 ng	EUR 603

RENBP Protein Vector (Mouse) (pPB-N-His)
PV223467	ABM	500 ng	EUR 603

RENBP Protein Vector (Mouse) (pPM-C-HA)
PV223468	ABM	500 ng	EUR 603

RENBP Protein Vector (Mouse) (pPM-C-His)
PV223469	ABM	500 ng	EUR 603

RENBP Protein Vector (Mouse) (pPB-C-His)
PV223470	ABM	500 ng	EUR 603

RENBP Protein Vector (Mouse) (pPB-N-His)
PV223471	ABM	500 ng	EUR 603

RENBP Protein Vector (Mouse) (pPM-C-HA)
PV223472	ABM	500 ng	EUR 603

RENBP Protein Vector (Mouse) (pPM-C-His)
PV223473	ABM	500 ng	EUR 603

Renbp 3'UTR GFP Stable Cell Line
TU167724	ABM	1.0 ml	Ask for price

RENBP 3'UTR Luciferase Stable Cell Line
TU019751	ABM	1.0 ml	EUR 2333

Renbp 3'UTR Luciferase Stable Cell Line
TU117724	ABM	1.0 ml	Ask for price

RENBP 3'UTR GFP Stable Cell Line
TU069751	ABM	1.0 ml	EUR 2333

Renbp 3'UTR GFP Stable Cell Line
TU267474	ABM	1.0 ml	Ask for price

Renbp 3'UTR Luciferase Stable Cell Line
TU217474	ABM	1.0 ml	Ask for price

Rat N acylglucosamine 2 epimerase(RENBP) ELISA kit
E02N0571-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat N acylglucosamine 2 epimerase(RENBP) ELISA kit
E02N0571-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat N acylglucosamine 2 epimerase(RENBP) ELISA kit
E02N0571-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse N acylglucosamine 2 epimerase(RENBP) ELISA kit
E03N0571-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse N acylglucosamine 2 epimerase(RENBP) ELISA kit
E03N0571-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse N acylglucosamine 2 epimerase(RENBP) ELISA kit
E03N0571-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit N acylglucosamine 2 epimerase(RENBP) ELISA kit
E04N0571-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit N acylglucosamine 2 epimerase(RENBP) ELISA kit
E04N0571-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit N acylglucosamine 2 epimerase(RENBP) ELISA kit
E04N0571-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acylglucosamine 2 epimerase(RENBP) ELISA kit
E01N0571-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acylglucosamine 2 epimerase(RENBP) ELISA kit
E01N0571-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acylglucosamine 2 epimerase(RENBP) ELISA kit
E01N0571-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog N acylglucosamine 2 epimerase(RENBP) ELISA kit
E08N0571-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog N acylglucosamine 2 epimerase(RENBP) ELISA kit
E08N0571-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog N acylglucosamine 2 epimerase(RENBP) ELISA kit
E08N0571-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey N acylglucosamine 2 epimerase(RENBP) ELISA kit
E09N0571-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey N acylglucosamine 2 epimerase(RENBP) ELISA kit
E09N0571-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.