RPL15

RPL15 antibody
70R-15325	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL15 antibody

RPL15 Antibody
34348-100ul	SAB	100ul	EUR 252

RPL15 Antibody
34348-50ul	SAB	50ul	EUR 187

RPL15 Antibody
DF3698	Affbiotech	200ul	EUR 304
Description: RPL15 Antibody detects endogenous levels of total RPL15.

RPL15 Antibody
CSB-PA278774-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL15 Antibody
CSB-PA278774-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL15 Antibody
1-CSB-PA040240	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RPL15 Antibody
1-CSB-PA207169	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

RPL15 Antibody
1-CSB-PA234128	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

RPL15 antibody
70R-33943	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL15 antibody

RPL15 Antibody
1-CSB-PA02435A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

RPL15 siRNA
20-abx904649	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL15 siRNA
20-abx931921	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL15 siRNA
20-abx931922	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RPL15 Antibody
ABD3698	Lifescience Market	100 ug	EUR 438

anti-RPL15
YF-PA14435	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to RPL15

anti-RPL15
YF-PA24604	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RPL15

RPL15 antibody (HRP)
60R-1802	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL15 antibody (HRP)

RPL15 antibody (FITC)
60R-1803	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL15 antibody (FITC)

RPL15 antibody (biotin)
60R-1804	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal RPL15 antibody (biotin)

RPL15 Blocking Peptide
DF3698-BP	Affbiotech	1mg	EUR 195

RPL15 Conjugated Antibody
C34348	SAB	100ul	EUR 397

RPL15 cloning plasmid
CSB-CL020144HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 615 Sequence: atgggtgcatacaagtacatccaggagctatggagaaagaagcagtctgatgtcatgcgctttcttctgagggtccgctgctggcagtaccgccagctctctgctctccacagggctccccgccccacccggcctgataaagcgcgccgactgggctacaaggccaagcaaggtta Show more
Description: A cloning plasmid for the RPL15 gene.

RPL15 cloning plasmid
CSB-CL020144HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 615 Sequence: atgggtgcatacaagtacatccaggagctatggagaaagaagcagtctgatgtcatgcgctttcttctgagggtccgctgctggcagtaccgccagctctctgctctccacagggctccccgccccacccggcctgataaagcgcgccgactgggctacaaggccaagcaaggtta Show more
Description: A cloning plasmid for the RPL15 gene.

RPL15 cloning plasmid
CSB-CL020144HU3-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 438 Sequence: atgggtgcatacaagtacatccaggagctatggagaaagaagcagtctgatgtcatgcgctttcttctgagggtccgctgctggcagtaccgccagctctctgctctccacagggctccccgccccacccggcctgataaagcgcgccgactgggctacaaggccaagcaaggtta Show more
Description: A cloning plasmid for the RPL15 gene.

RPL15 Polyclonal Antibody
A51741	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

anti- RPL15 antibody
FNab07415	FN Test	100µg	EUR 548.75
Immunogen: ribosomal protein L15 Uniprot ID: P61313 Gene ID: 6138 Research Area: Metabolism
Description: Antibody raised against RPL15

Anti-RPL15 antibody
PAab07415	Lifescience Market	100 ug	EUR 386

pCMV-SPORT6-RPL15
PVT13705	Lifescience Market	2 ug	EUR 391

Canine RPL15 ELISA KIT
ELI-14642d	Lifescience Market	96 Tests	EUR 928

RPL15 ELISA KIT|Human
EF002572	Lifescience Market	96 Tests	EUR 689

Rat RPL15 shRNA Plasmid
20-abx987921	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RPL15 shRNA Plasmid
20-abx975633	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL15 Antibody, HRP conjugated
1-CSB-PA02435B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL15 Antibody, FITC conjugated
1-CSB-PA02435C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL15 Antibody, Biotin conjugated
1-CSB-PA02435D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human RPL15 shRNA Plasmid
20-abx954129	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RPL15 Recombinant Protein (Human)
RP026869	ABM	100 ug	Ask for price

RPL15 Recombinant Protein (Human)
RP026872	ABM	100 ug	Ask for price

RPL15 Recombinant Protein (Human)
RP026875	ABM	100 ug	Ask for price

RPL15 Recombinant Protein (Mouse)
RP168974	ABM	100 ug	Ask for price

RPL15 Recombinant Protein (Rat)
RP226613	ABM	100 ug	Ask for price

Polyclonal RPL15 Antibody (N-term)
APR03737G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPL15 (N-term). This antibody is tested and proven to work in the following applications:

Ribosomal Protein L15 (RPL15) Antibody
abx145575-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Ribosomal Protein L15 (RPL15) Antibody
20-abx241276	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein L15 (RPL15) Antibody
20-abx241277	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Ribosomal Protein L15 (RPL15) Antibody
abx237415-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Ribosomal Protein L15 (RPL15) Antibody
20-abx328890	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Ribosomal Protein L15 (RPL15) Antibody
abx332718-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

RPL15 Polyclonal Antibody, HRP Conjugated
A51742	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

RPL15 Polyclonal Antibody, FITC Conjugated
A51743	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

RPL15 Polyclonal Antibody, Biotin Conjugated
A51744	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Rpl15 ORF Vector (Rat) (pORF)
ORF075539	ABM	1.0 ug DNA	EUR 506

RPL15 ORF Vector (Human) (pORF)
ORF008957	ABM	1.0 ug DNA	EUR 95

RPL15 ORF Vector (Human) (pORF)
ORF008958	ABM	1.0 ug DNA	EUR 95

RPL15 ORF Vector (Human) (pORF)
ORF008959	ABM	1.0 ug DNA	EUR 95

Rpl15 ORF Vector (Mouse) (pORF)
ORF056326	ABM	1.0 ug DNA	EUR 506

Anti-RPL15/Ribosomal Protein L15 Antibody
A07136	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal RPL15/Ribosomal Protein L15 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Human 60S ribosomal protein L15 (RPL15)
1-CSB-RP024354h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 51 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S ribosomal protein L15(RPL15) expressed in E.coli

Polyclonal RPL15 antibody - N-terminal region
APR01605G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPL15 - N-terminal region. This antibody is tested and proven to work in the following applications:

Ribosomal Protein L15 (RPL15) Antibody Pair
abx117439-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010
Shipped within 5-10 working days.

60S Ribosomal Protein L15 (RPL15) Antibody
20-abx109468	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rpl15 sgRNA CRISPR Lentivector set (Mouse)
K4992401	ABM	3 x 1.0 ug	EUR 339

Rpl15 sgRNA CRISPR Lentivector set (Rat)
K7194101	ABM	3 x 1.0 ug	EUR 339

RPL15 sgRNA CRISPR Lentivector set (Human)
K1910201	ABM	3 x 1.0 ug	EUR 339

Human Ribosomal Protein L15 (RPL15) ELISA Kit
abx382901-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rpl15 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4992402	ABM	1.0 ug DNA	EUR 154

Rpl15 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4992403	ABM	1.0 ug DNA	EUR 154

Rpl15 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4992404	ABM	1.0 ug DNA	EUR 154

Rpl15 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7194102	ABM	1.0 ug DNA	EUR 154

Rpl15 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7194103	ABM	1.0 ug DNA	EUR 154

Rpl15 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7194104	ABM	1.0 ug DNA	EUR 154

RPL15 sgRNA CRISPR Lentivector (Human) (Target 1)
K1910202	ABM	1.0 ug DNA	EUR 154

RPL15 sgRNA CRISPR Lentivector (Human) (Target 2)
K1910203	ABM	1.0 ug DNA	EUR 154

RPL15 sgRNA CRISPR Lentivector (Human) (Target 3)
K1910204	ABM	1.0 ug DNA	EUR 154

RPL15 Protein Vector (Rat) (pPB-C-His)
PV302154	ABM	500 ng	EUR 603

RPL15 Protein Vector (Rat) (pPB-N-His)
PV302155	ABM	500 ng	EUR 603

RPL15 Protein Vector (Rat) (pPM-C-HA)
PV302156	ABM	500 ng	EUR 603

RPL15 Protein Vector (Rat) (pPM-C-His)
PV302157	ABM	500 ng	EUR 603

RPL15 Protein Vector (Human) (pPB-C-His)
PV035825	ABM	500 ng	EUR 329

RPL15 Protein Vector (Human) (pPB-N-His)
PV035826	ABM	500 ng	EUR 329

RPL15 Protein Vector (Human) (pPM-C-HA)
PV035827	ABM	500 ng	EUR 329

RPL15 Protein Vector (Human) (pPM-C-His)
PV035828	ABM	500 ng	EUR 329

RPL15 Protein Vector (Human) (pPB-C-His)
PV035829	ABM	500 ng	EUR 329

RPL15 Protein Vector (Human) (pPB-N-His)
PV035830	ABM	500 ng	EUR 329