RPL15 antibody

70R-15325 100 ug
EUR 327
Description: Rabbit polyclonal RPL15 antibody

RPL15 Antibody

34348-100ul 100ul
EUR 252

RPL15 Antibody

34348-50ul 50ul
EUR 187

RPL15 Antibody

DF3698 200ul
EUR 304
Description: RPL15 Antibody detects endogenous levels of total RPL15.

RPL15 Antibody

CSB-PA278774-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL15 Antibody

CSB-PA278774-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL15 Antibody

1-CSB-PA040240
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RPL15 Antibody

1-CSB-PA207169
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

RPL15 Antibody

1-CSB-PA234128
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

RPL15 antibody

70R-33943 100 ug
EUR 327
Description: Rabbit polyclonal RPL15 antibody

RPL15 Antibody

1-CSB-PA02435A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

RPL15 siRNA

20-abx904649
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL15 siRNA

20-abx931921
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL15 siRNA

20-abx931922
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL15 Antibody

ABD3698 100 ug
EUR 438

anti-RPL15

YF-PA14435 100 ug
EUR 403
Description: Rabbit polyclonal to RPL15

anti-RPL15

YF-PA24604 50 ul
EUR 334
Description: Mouse polyclonal to RPL15

RPL15 antibody (HRP)

60R-1802 100 ug
EUR 327
Description: Rabbit polyclonal RPL15 antibody (HRP)

RPL15 antibody (FITC)

60R-1803 100 ug
EUR 327
Description: Rabbit polyclonal RPL15 antibody (FITC)

RPL15 antibody (biotin)

60R-1804 100 ug
EUR 327
Description: Rabbit polyclonal RPL15 antibody (biotin)

RPL15 Blocking Peptide

DF3698-BP 1mg
EUR 195

RPL15 Conjugated Antibody

C34348 100ul
EUR 397

RPL15 cloning plasmid

CSB-CL020144HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 615
  • Sequence: atgggtgcatacaagtacatccaggagctatggagaaagaagcagtctgatgtcatgcgctttcttctgagggtccgctgctggcagtaccgccagctctctgctctccacagggctccccgccccacccggcctgataaagcgcgccgactgggctacaaggccaagcaaggtta
  • Show more
Description: A cloning plasmid for the RPL15 gene.

RPL15 cloning plasmid

CSB-CL020144HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 615
  • Sequence: atgggtgcatacaagtacatccaggagctatggagaaagaagcagtctgatgtcatgcgctttcttctgagggtccgctgctggcagtaccgccagctctctgctctccacagggctccccgccccacccggcctgataaagcgcgccgactgggctacaaggccaagcaaggtta
  • Show more
Description: A cloning plasmid for the RPL15 gene.

RPL15 cloning plasmid

CSB-CL020144HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 438
  • Sequence: atgggtgcatacaagtacatccaggagctatggagaaagaagcagtctgatgtcatgcgctttcttctgagggtccgctgctggcagtaccgccagctctctgctctccacagggctccccgccccacccggcctgataaagcgcgccgactgggctacaaggccaagcaaggtta
  • Show more
Description: A cloning plasmid for the RPL15 gene.

RPL15 Polyclonal Antibody

A51741 100 µg
EUR 570.55
Description: Ask the seller for details

anti- RPL15 antibody

FNab07415 100µg
EUR 548.75
  • Immunogen: ribosomal protein L15
  • Uniprot ID: P61313
  • Gene ID: 6138
  • Research Area: Metabolism
Description: Antibody raised against RPL15

Anti-RPL15 antibody

PAab07415 100 ug
EUR 386

pCMV-SPORT6-RPL15

PVT13705 2 ug
EUR 391

Canine RPL15 ELISA KIT

ELI-14642d 96 Tests
EUR 928

RPL15 ELISA KIT|Human

EF002572 96 Tests
EUR 689

Rat RPL15 shRNA Plasmid

20-abx987921
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RPL15 shRNA Plasmid

20-abx975633
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL15 Antibody, HRP conjugated

1-CSB-PA02435B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL15 Antibody, FITC conjugated

1-CSB-PA02435C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL15 Antibody, Biotin conjugated

1-CSB-PA02435D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL15. Recognizes RPL15 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human RPL15 shRNA Plasmid

20-abx954129
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL15 Recombinant Protein (Human)

RP026869 100 ug Ask for price

RPL15 Recombinant Protein (Human)

RP026872 100 ug Ask for price

RPL15 Recombinant Protein (Human)

RP026875 100 ug Ask for price

RPL15 Recombinant Protein (Mouse)

RP168974 100 ug Ask for price

RPL15 Recombinant Protein (Rat)

RP226613 100 ug Ask for price

Polyclonal RPL15 Antibody (N-term)

APR03737G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPL15 (N-term). This antibody is tested and proven to work in the following applications:

Ribosomal Protein L15 (RPL15) Antibody

abx145575-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ribosomal Protein L15 (RPL15) Antibody

20-abx241276
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L15 (RPL15) Antibody

20-abx241277
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L15 (RPL15) Antibody

abx237415-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ribosomal Protein L15 (RPL15) Antibody

20-abx328890
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L15 (RPL15) Antibody

abx332718-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

RPL15 Polyclonal Antibody, HRP Conjugated

A51742 100 µg
EUR 570.55
Description: The best epigenetics products

RPL15 Polyclonal Antibody, FITC Conjugated

A51743 100 µg
EUR 570.55
Description: kits suitable for this type of research

RPL15 Polyclonal Antibody, Biotin Conjugated

A51744 100 µg
EUR 570.55
Description: fast delivery possible

Rpl15 ORF Vector (Rat) (pORF)

ORF075539 1.0 ug DNA
EUR 506

RPL15 ORF Vector (Human) (pORF)

ORF008957 1.0 ug DNA
EUR 95

RPL15 ORF Vector (Human) (pORF)

ORF008958 1.0 ug DNA
EUR 95

RPL15 ORF Vector (Human) (pORF)

ORF008959 1.0 ug DNA
EUR 95

Rpl15 ORF Vector (Mouse) (pORF)

ORF056326 1.0 ug DNA
EUR 506

Anti-RPL15/Ribosomal Protein L15 Antibody

A07136 100ul
EUR 397
Description: Rabbit Polyclonal RPL15/Ribosomal Protein L15 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Human 60S ribosomal protein L15 (RPL15)

1-CSB-RP024354h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 51 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S ribosomal protein L15(RPL15) expressed in E.coli

Polyclonal RPL15 antibody - N-terminal region

APR01605G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RPL15 - N-terminal region. This antibody is tested and proven to work in the following applications:

Ribosomal Protein L15 (RPL15) Antibody Pair

abx117439-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

60S Ribosomal Protein L15 (RPL15) Antibody

20-abx109468
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rpl15 sgRNA CRISPR Lentivector set (Mouse)

K4992401 3 x 1.0 ug
EUR 339

Rpl15 sgRNA CRISPR Lentivector set (Rat)

K7194101 3 x 1.0 ug
EUR 339

RPL15 sgRNA CRISPR Lentivector set (Human)

K1910201 3 x 1.0 ug
EUR 339

Human Ribosomal Protein L15 (RPL15) ELISA Kit

abx382901-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rpl15 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4992402 1.0 ug DNA
EUR 154

Rpl15 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4992403 1.0 ug DNA
EUR 154

Rpl15 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4992404 1.0 ug DNA
EUR 154

Rpl15 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7194102 1.0 ug DNA
EUR 154

Rpl15 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7194103 1.0 ug DNA
EUR 154

Rpl15 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7194104 1.0 ug DNA
EUR 154

RPL15 sgRNA CRISPR Lentivector (Human) (Target 1)

K1910202 1.0 ug DNA
EUR 154

RPL15 sgRNA CRISPR Lentivector (Human) (Target 2)

K1910203 1.0 ug DNA
EUR 154

RPL15 sgRNA CRISPR Lentivector (Human) (Target 3)

K1910204 1.0 ug DNA
EUR 154

RPL15 Protein Vector (Rat) (pPB-C-His)

PV302154 500 ng
EUR 603

RPL15 Protein Vector (Rat) (pPB-N-His)

PV302155 500 ng
EUR 603

RPL15 Protein Vector (Rat) (pPM-C-HA)

PV302156 500 ng
EUR 603

RPL15 Protein Vector (Rat) (pPM-C-His)

PV302157 500 ng
EUR 603

RPL15 Protein Vector (Human) (pPB-C-His)

PV035825 500 ng
EUR 329

RPL15 Protein Vector (Human) (pPB-N-His)

PV035826 500 ng
EUR 329

RPL15 Protein Vector (Human) (pPM-C-HA)

PV035827 500 ng
EUR 329

RPL15 Protein Vector (Human) (pPM-C-His)

PV035828 500 ng
EUR 329

RPL15 Protein Vector (Human) (pPB-C-His)

PV035829 500 ng
EUR 329

RPL15 Protein Vector (Human) (pPB-N-His)

PV035830 500 ng
EUR 329