RPL31 antibody

70R-19979 50 ul
EUR 435
Description: Rabbit polyclonal RPL31 antibody

RPL31 Antibody

34355-100ul 100ul
EUR 252

RPL31 Antibody

34355-50ul 50ul
EUR 187

RPL31 Antibody

1-CSB-PA040242
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL31. Recognizes RPL31 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

RPL31 Antibody

CSB-PA170328-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL31. Recognizes RPL31 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

RPL31 Antibody

CSB-PA170328-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL31. Recognizes RPL31 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

RPL31 antibody

70R-33953 100 ug
EUR 327
Description: Rabbit polyclonal RPL31 antibody

RPL31 Antibody

AF0854 200ul
EUR 304
Description: RPL31 Antibody detects endogenous levels of RPL31.

RPL31 Antibody

1-CSB-PA020227GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL31. Recognizes RPL31 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RPL31 siRNA

20-abx904661
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL31 siRNA

20-abx931956
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL31 siRNA

20-abx931957
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL31 Antibody

ABD13238 100 ug
EUR 438

RPL31 Antibody

ABF0854 100 ug
EUR 438

pOTB7-RPL31

PVT18514 2 ug
EUR 231

anti-RPL31

YF-PA24609 50 ul
EUR 334
Description: Mouse polyclonal to RPL31

RPL31 Blocking Peptide

AF0854-BP 1mg
EUR 195

RPL31 Conjugated Antibody

C34355 100ul
EUR 397

RPL31 cloning plasmid

CSB-CL020227HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 378
  • Sequence: atggctcccgcaaagaagggtggcgagaagaaaaagggccgttctgccatcaacgaagtggtaacccgagaatacaccatcaacattcacaagcgcatccatggagtgggcttcaagaagcgtgcacctcgggcactcaaagagattcggaaatttgccatgaaggagatgggaac
  • Show more
Description: A cloning plasmid for the RPL31 gene.

RPL31 Rabbit pAb

A4089-100ul 100 ul
EUR 308

RPL31 Rabbit pAb

A4089-200ul 200 ul
EUR 459

RPL31 Rabbit pAb

A4089-20ul 20 ul Ask for price

RPL31 Rabbit pAb

A4089-50ul 50 ul Ask for price

RPL31 Rabbit pAb

A17527-100ul 100 ul
EUR 308

RPL31 Rabbit pAb

A17527-200ul 200 ul
EUR 459

RPL31 Rabbit pAb

A17527-20ul 20 ul
EUR 183

RPL31 Rabbit pAb

A17527-50ul 50 ul
EUR 223

anti- RPL31 antibody

FNab07432 100µg
EUR 548.75
  • Immunogen: ribosomal protein L31
  • Uniprot ID: P62899
  • Gene ID: 6160
  • Research Area: Metabolism
Description: Antibody raised against RPL31

Anti-RPL31 antibody

PAab07432 100 ug
EUR 386

Anti-RPL31 antibody

STJ25398 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L31E family of ribosomal proteins. It is located in the cytoplasm. Higher levels of expression of this gene in familial adenomatous polyps compared to matched normal tissues have been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Anti-RPL31 antibody

STJ119619 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L31E family of ribosomal proteins. It is located in the cytoplasm. Higher levels of expression of this gene in familial adenomatous polyps compared to matched normal tissues have been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

RPL31 protein (His tag)

80R-3566 20 ug
EUR 327
Description: Purified recombinant RPL31 protein (His tag)

RPL31 ELISA KIT|Human

EF002589 96 Tests
EUR 689

Rat RPL31 shRNA Plasmid

20-abx986192
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RPL31 shRNA Plasmid

20-abx954145
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RPL31 shRNA Plasmid

20-abx980167
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL31 Recombinant Protein (Human)

RP026965 100 ug Ask for price

RPL31 Recombinant Protein (Mouse)

RP169034 100 ug Ask for price

RPL31 Recombinant Protein (Mouse)

RP169037 100 ug Ask for price

RPL31 Recombinant Protein (Mouse)

RP169040 100 ug Ask for price

RPL31 Recombinant Protein (Rat)

RP226667 100 ug Ask for price

Ribosomal Protein L31 (RPL31) Antibody

20-abx003008
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L31 (RPL31) Antibody

20-abx115240
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L31 (RPL31) Antibody

abx034411-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ribosomal Protein L31 (RPL31) Antibody

abx034411-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ribosomal Protein L31 (RPL31) Antibody

abx237432-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ribosomal Protein L31 (RPL31) Antibody

abx331386-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Ribosomal Protein L31 (RPL31) Antibody

20-abx326584
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rpl31 ORF Vector (Rat) (pORF)

ORF075557 1.0 ug DNA
EUR 506

RPL31 ORF Vector (Human) (pORF)

ORF008989 1.0 ug DNA
EUR 95

Rpl31 ORF Vector (Mouse) (pORF)

ORF056346 1.0 ug DNA
EUR 506

Rpl31 ORF Vector (Mouse) (pORF)

ORF056347 1.0 ug DNA
EUR 506

Rpl31 ORF Vector (Mouse) (pORF)

ORF056348 1.0 ug DNA
EUR 506

Anti-RPL31/Ribosomal Protein L31 Antibody

A07002-1 100ul
EUR 397
Description: Rabbit Polyclonal RPL31/Ribosomal Protein L31 Antibody. Validated in IHC and tested in Human, Mouse, Rat.

Human 60S ribosomal protein L31 (RPL31)

1-CSB-RP137174h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 18.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S ribosomal protein L31(RPL31) expressed in E.coli

Rpl31 sgRNA CRISPR Lentivector set (Rat)

K7083701 3 x 1.0 ug
EUR 339

Rpl31 sgRNA CRISPR Lentivector set (Mouse)

K4395901 3 x 1.0 ug
EUR 339

RPL31 sgRNA CRISPR Lentivector set (Human)

K1960101 3 x 1.0 ug
EUR 339

Human Ribosomal Protein L31 (RPL31) ELISA Kit

abx382916-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rpl31 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7083702 1.0 ug DNA
EUR 154

Rpl31 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7083703 1.0 ug DNA
EUR 154

Rpl31 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7083704 1.0 ug DNA
EUR 154

Rpl31 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4395902 1.0 ug DNA
EUR 154

Rpl31 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4395903 1.0 ug DNA
EUR 154

Rpl31 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4395904 1.0 ug DNA
EUR 154

RPL31 sgRNA CRISPR Lentivector (Human) (Target 1)

K1960102 1.0 ug DNA
EUR 154

RPL31 sgRNA CRISPR Lentivector (Human) (Target 2)

K1960103 1.0 ug DNA
EUR 154

RPL31 sgRNA CRISPR Lentivector (Human) (Target 3)

K1960104 1.0 ug DNA
EUR 154

RPL31 Ribosomal Protein L31 Human Recombinant Protein

PROTP62899 Regular: 10ug
EUR 317
Description: RPL31 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain topological domain containing 148 amino acids (1-125 a.a) and having a molecular mass of 16.9kDa.RPL31 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RPL31 Protein Vector (Rat) (pPB-C-His)

PV302226 500 ng
EUR 603

RPL31 Protein Vector (Rat) (pPB-N-His)

PV302227 500 ng
EUR 603

RPL31 Protein Vector (Rat) (pPM-C-HA)

PV302228 500 ng
EUR 603

RPL31 Protein Vector (Rat) (pPM-C-His)

PV302229 500 ng
EUR 603

RPL31 Protein Vector (Human) (pPB-C-His)

PV035953 500 ng
EUR 329

RPL31 Protein Vector (Human) (pPB-N-His)

PV035954 500 ng
EUR 329

RPL31 Protein Vector (Human) (pPM-C-HA)

PV035955 500 ng
EUR 329

RPL31 Protein Vector (Human) (pPM-C-His)

PV035956 500 ng
EUR 329

RPL31 Protein Vector (Mouse) (pPB-C-His)

PV225382 500 ng
EUR 603

RPL31 Protein Vector (Mouse) (pPB-N-His)

PV225383 500 ng
EUR 603

RPL31 Protein Vector (Mouse) (pPM-C-HA)

PV225384 500 ng
EUR 603

RPL31 Protein Vector (Mouse) (pPM-C-His)

PV225385 500 ng
EUR 603

RPL31 Protein Vector (Mouse) (pPB-C-His)

PV225386 500 ng
EUR 603

RPL31 Protein Vector (Mouse) (pPB-N-His)

PV225387 500 ng
EUR 603

RPL31 Protein Vector (Mouse) (pPM-C-HA)

PV225388 500 ng
EUR 603

RPL31 Protein Vector (Mouse) (pPM-C-His)

PV225389 500 ng
EUR 603