RPL31 antibody
70R-19979	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal RPL31 antibody

RPL31 Antibody
34355-100ul	SAB	100ul	EUR 252.00

RPL31 Antibody
34355-50ul	SAB	50ul	EUR 187.00

RPL31 Antibody
1-CSB-PA040242	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL31. Recognizes RPL31 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

RPL31 Antibody
CSB-PA170328-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against RPL31. Recognizes RPL31 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

RPL31 Antibody
CSB-PA170328-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against RPL31. Recognizes RPL31 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

RPL31 antibody
70R-33953	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal RPL31 antibody

RPL31 Antibody
AF0854	Affbiotech	200ul	EUR 304.00
Description: RPL31 Antibody detects endogenous levels of RPL31.

RPL31 Antibody
1-CSB-PA020227GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL31. Recognizes RPL31 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RPL31 siRNA
20-abx904661	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RPL31 siRNA
20-abx931956	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RPL31 siRNA
20-abx931957	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RPL31 Antibody
ABD13238	Lifescience Market	100 ug	EUR 438.00

RPL31 Antibody
ABF0854	Lifescience Market	100 ug	EUR 438.00

pOTB7-RPL31
PVT18514	Lifescience Market	2 ug	EUR 231.00

anti-RPL31
YF-PA24609	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to RPL31

RPL31 Blocking Peptide
AF0854-BP	Affbiotech	1mg	EUR 195.00

RPL31 Conjugated Antibody
C34355	SAB	100ul	EUR 397.00

RPL31 cloning plasmid
CSB-CL020227HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 378 Sequence: atggctcccgcaaagaagggtggcgagaagaaaaagggccgttctgccatcaacgaagtggtaacccgagaatacaccatcaacattcacaagcgcatccatggagtgggcttcaagaagcgtgcacctcgggcactcaaagagattcggaaatttgccatgaaggagatgggaac Show more
Description: A cloning plasmid for the RPL31 gene.

RPL31 Rabbit pAb
A4089-100ul	Abclonal	100 ul	EUR 308.00

RPL31 Rabbit pAb
A4089-200ul	Abclonal	200 ul	EUR 459.00

RPL31 Rabbit pAb
A4089-20ul	Abclonal	20 ul	Ask for price

RPL31 Rabbit pAb
A4089-50ul	Abclonal	50 ul	Ask for price

RPL31 Rabbit pAb
A17527-100ul	Abclonal	100 ul	EUR 308.00

RPL31 Rabbit pAb
A17527-200ul	Abclonal	200 ul	EUR 459.00

RPL31 Rabbit pAb
A17527-20ul	Abclonal	20 ul	EUR 183.00

RPL31 Rabbit pAb
A17527-50ul	Abclonal	50 ul	EUR 223.00

anti- RPL31 antibody
FNab07432	FN Test	100µg	EUR 548.75
Immunogen: ribosomal protein L31 Uniprot ID: P62899 Gene ID: 6160 Research Area: Metabolism
Description: Antibody raised against RPL31

Anti-RPL31 antibody
PAab07432	Lifescience Market	100 ug	EUR 386.00

Anti-RPL31 antibody
STJ25398	St John's Laboratory	100 µl	EUR 277.00
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L31E family of ribosomal proteins. It is located in the cytoplasm. Higher levels of expression of this gene in familial adenomatous polyps compared to matched normal tissues have been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Anti-RPL31 antibody
STJ119619	St John's Laboratory	100 µl	EUR 277.00
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L31E family of ribosomal proteins. It is located in the cytoplasm. Higher levels of expression of this gene in familial adenomatous polyps compared to matched normal tissues have been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

RPL31 protein (His tag)
80R-3566	Fitzgerald	20 ug	EUR 327.00
Description: Purified recombinant RPL31 protein (His tag)

RPL31 ELISA KIT|Human
EF002589	Lifescience Market	96 Tests	EUR 689.00

Rat RPL31 shRNA Plasmid
20-abx986192	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human RPL31 shRNA Plasmid
20-abx954145	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse RPL31 shRNA Plasmid
20-abx980167	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

RPL31 Recombinant Protein (Human)
RP026965	ABM	100 ug	Ask for price

RPL31 Recombinant Protein (Mouse)
RP169034	ABM	100 ug	Ask for price

RPL31 Recombinant Protein (Mouse)
RP169037	ABM	100 ug	Ask for price

RPL31 Recombinant Protein (Mouse)
RP169040	ABM	100 ug	Ask for price

RPL31 Recombinant Protein (Rat)
RP226667	ABM	100 ug	Ask for price

Ribosomal Protein L31 (RPL31) Antibody
20-abx003008	Abbexa	EUR 411.00 EUR 592.00	0 1
Shipped within 5-10 working days.

Ribosomal Protein L31 (RPL31) Antibody
20-abx115240	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

Ribosomal Protein L31 (RPL31) Antibody
abx034411-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Ribosomal Protein L31 (RPL31) Antibody
abx034411-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Ribosomal Protein L31 (RPL31) Antibody
abx237432-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Ribosomal Protein L31 (RPL31) Antibody
abx331386-100ul	Abbexa	100 ul	EUR 425.00
Shipped within 5-10 working days.

Ribosomal Protein L31 (RPL31) Antibody
20-abx326584	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Rpl31 ORF Vector (Rat) (pORF)
ORF075557	ABM	1.0 ug DNA	EUR 506.00

RPL31 ORF Vector (Human) (pORF)
ORF008989	ABM	1.0 ug DNA	EUR 95.00

Rpl31 ORF Vector (Mouse) (pORF)
ORF056346	ABM	1.0 ug DNA	EUR 506.00

Rpl31 ORF Vector (Mouse) (pORF)
ORF056347	ABM	1.0 ug DNA	EUR 506.00

Rpl31 ORF Vector (Mouse) (pORF)
ORF056348	ABM	1.0 ug DNA	EUR 506.00

Anti-RPL31/Ribosomal Protein L31 Antibody
A07002-1	BosterBio	100ul	EUR 397.00
Description: Rabbit Polyclonal RPL31/Ribosomal Protein L31 Antibody. Validated in IHC and tested in Human, Mouse, Rat.

Human 60S ribosomal protein L31 (RPL31)
1-CSB-RP137174h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	0 1 2 3 4 5
MW: 18.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S ribosomal protein L31(RPL31) expressed in E.coli

Rpl31 sgRNA CRISPR Lentivector set (Rat)
K7083701	ABM	3 x 1.0 ug	EUR 339.00

Rpl31 sgRNA CRISPR Lentivector set (Mouse)
K4395901	ABM	3 x 1.0 ug	EUR 339.00

RPL31 sgRNA CRISPR Lentivector set (Human)
K1960101	ABM	3 x 1.0 ug	EUR 339.00

Human Ribosomal Protein L31 (RPL31) ELISA Kit
abx382916-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Rpl31 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7083702	ABM	1.0 ug DNA	EUR 154.00

Rpl31 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7083703	ABM	1.0 ug DNA	EUR 154.00

Rpl31 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7083704	ABM	1.0 ug DNA	EUR 154.00

Rpl31 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4395902	ABM	1.0 ug DNA	EUR 154.00

Rpl31 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4395903	ABM	1.0 ug DNA	EUR 154.00

Rpl31 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4395904	ABM	1.0 ug DNA	EUR 154.00

RPL31 sgRNA CRISPR Lentivector (Human) (Target 1)
K1960102	ABM	1.0 ug DNA	EUR 154.00

RPL31 sgRNA CRISPR Lentivector (Human) (Target 2)
K1960103	ABM	1.0 ug DNA	EUR 154.00

RPL31 sgRNA CRISPR Lentivector (Human) (Target 3)
K1960104	ABM	1.0 ug DNA	EUR 154.00

RPL31 Ribosomal Protein L31 Human Recombinant Protein
PROTP62899	BosterBio	Regular: 10ug	EUR 317.00
Description: RPL31 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain topological domain containing 148 amino acids (1-125 a.a) and having a molecular mass of 16.9kDa.RPL31 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RPL31 Protein Vector (Rat) (pPB-C-His)
PV302226	ABM	500 ng	EUR 603.00

RPL31 Protein Vector (Rat) (pPB-N-His)
PV302227	ABM	500 ng	EUR 603.00

RPL31 Protein Vector (Rat) (pPM-C-HA)
PV302228	ABM	500 ng	EUR 603.00

RPL31 Protein Vector (Rat) (pPM-C-His)
PV302229	ABM	500 ng	EUR 603.00

RPL31 Protein Vector (Human) (pPB-C-His)
PV035953	ABM	500 ng	EUR 329.00

RPL31 Protein Vector (Human) (pPB-N-His)
PV035954	ABM	500 ng	EUR 329.00

RPL31 Protein Vector (Human) (pPM-C-HA)
PV035955	ABM	500 ng	EUR 329.00

RPL31 Protein Vector (Human) (pPM-C-His)
PV035956	ABM	500 ng	EUR 329.00

RPL31 Protein Vector (Mouse) (pPB-C-His)
PV225382	ABM	500 ng	EUR 603.00

RPL31 Protein Vector (Mouse) (pPB-N-His)
PV225383	ABM	500 ng	EUR 603.00

RPL31 Protein Vector (Mouse) (pPM-C-HA)
PV225384	ABM	500 ng	EUR 603.00

RPL31 Protein Vector (Mouse) (pPM-C-His)
PV225385	ABM	500 ng	EUR 603.00

RPL31 Protein Vector (Mouse) (pPB-C-His)
PV225386	ABM	500 ng	EUR 603.00

RPL31 Protein Vector (Mouse) (pPB-N-His)
PV225387	ABM	500 ng	EUR 603.00

RPL31 Protein Vector (Mouse) (pPM-C-HA)
PV225388	ABM	500 ng	EUR 603.00

RPL31 Protein Vector (Mouse) (pPM-C-His)
PV225389	ABM	500 ng	EUR 603.00