RPL35

RPL35 Antibody
34357-100ul	SAB	100ul	EUR 252.00

RPL35 Antibody
34357-50ul	SAB	50ul	EUR 187.00

RPL35 Antibody
1-CSB-PA003990	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL35. Recognizes RPL35 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

RPL35 Antibody
CSB-PA980122-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against RPL35. Recognizes RPL35 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL35 Antibody
CSB-PA980122-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against RPL35. Recognizes RPL35 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL35 Antibody
DF3709	Affbiotech	200ul	EUR 304.00
Description: RPL35 Antibody detects endogenous levels of total RPL35.

RPL35 antibody
70R-50859	Fitzgerald	100 ul	EUR 244.00
Description: Purified Polyclonal RPL35 antibody

RPL35 antibody
70R-33955	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal RPL35 antibody

RPL35 siRNA
20-abx904664	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RPL35 siRNA
20-abx931964	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RPL35 siRNA
20-abx931965	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RPL35 Antibody
ABD13239	Lifescience Market	100 ug	EUR 438.00

RPL35 Antibody
ABD3709	Lifescience Market	100 ug	EUR 438.00

pOTB7-RPL35
PVT18263	Lifescience Market	2 ug	EUR 231.00

anti-RPL35
YF-PA25770	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to RPL35

RPL35 Blocking Peptide
DF3709-BP	Affbiotech	1mg	EUR 195.00

RPL35 Blocking Peptide
20-abx063734	Abbexa	EUR 272.00 EUR 411.00	0 1
Shipped within 5-10 working days.

RPL35 Conjugated Antibody
C34357	SAB	100ul	EUR 397.00

RPL35 cloning plasmid
CSB-CL020247HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 372 Sequence: atggccaagatcaaggctcgagatcttcgcgggaagaagaaggaggagctgctgaaacagctggacgacctgaaggtggagctgtcccagctgcgcgtcgccaaagtgacaggcggtgcggcctccaagctctctaagatccgagtcgtccggaaatccattgcccgtgttctcac Show more
Description: A cloning plasmid for the RPL35 gene.

RPL35 cloning plasmid
CSB-CL020247HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 372 Sequence: atggccaagatcaaggctcgagatcttcgcgggaagaagaaggaggagctgctgaaacagctggacgacctgaaggtggagctgtcccagctgcgcgtcgccaaagtgacaggcggtgcggcctccaagctctctaagatccgagtcgtccggaaatccattgcccgtgttctcac Show more
Description: A cloning plasmid for the RPL35 gene.

RPL35 Rabbit pAb
A9043-100ul	Abclonal	100 ul	EUR 308.00

RPL35 Rabbit pAb
A9043-200ul	Abclonal	200 ul	EUR 459.00

RPL35 Rabbit pAb
A9043-20ul	Abclonal	20 ul	Ask for price

RPL35 Rabbit pAb
A9043-50ul	Abclonal	50 ul	Ask for price

RPL35 Polyclonal Antibody
ABP60252-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from part region of human RPL35 protein Applications tips:
Description: A polyclonal antibody for detection of RPL35 from Human, Mouse, Rat. This RPL35 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPL35 protein

RPL35 Polyclonal Antibody
ABP60252-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from part region of human RPL35 protein Applications tips:
Description: A polyclonal antibody for detection of RPL35 from Human, Mouse, Rat. This RPL35 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPL35 protein

RPL35 Polyclonal Antibody
ABP60252-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from part region of human RPL35 protein Applications tips:
Description: A polyclonal antibody for detection of RPL35 from Human, Mouse, Rat. This RPL35 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPL35 protein

anti- RPL35 antibody
FNab07434	FN Test	100µg	EUR 548.75
Immunogen: ribosomal protein L35 Uniprot ID: P42766 Gene ID: 11224 Research Area: Metabolism
Description: Antibody raised against RPL35

RPL35 Polyclonal Antibody
ES8927-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against RPL35 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RPL35 Polyclonal Antibody
ES8927-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against RPL35 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-RPL35 antibody
PAab07434	Lifescience Market	100 ug	EUR 386.00

Anti-RPL35 antibody
STJ111539	St John's Laboratory	100 µl	EUR 277.00
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L29P family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Anti-RPL35 antibody
STJ99645	St John's Laboratory	200 µl	EUR 197.00
Description: Rabbit polyclonal to RPL35.

RPL35 protein (His tag)
80R-3971	Fitzgerald	20 ug	EUR 349.00
Description: Recombinant Human RPL35 protein

RPL35 ELISA KIT|Human
EF002591	Lifescience Market	96 Tests	EUR 689.00

Rat RPL35 shRNA Plasmid
20-abx988825	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse RPL35 shRNA Plasmid
20-abx975637	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human RPL35 shRNA Plasmid
20-abx957692	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

RPL35 Recombinant Protein (Human)
RP026977	ABM	100 ug	Ask for price

RPL35 Recombinant Protein (Human)
RP026980	ABM	100 ug	Ask for price

RPL35 Recombinant Protein (Mouse)
RP169055	ABM	100 ug	Ask for price

RPL35 Recombinant Protein (Rat)
RP226676	ABM	100 ug	Ask for price

Ribosomal Protein L35 (RPL35) Antibody
20-abx008277	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	0 1 2
Shipped within 5-10 working days.

Ribosomal Protein L35 (RPL35) Antibody
abx027115-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Ribosomal Protein L35 (RPL35) Antibody
abx027115-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Ribosomal Protein L35 (RPL35) Antibody
20-abx123478	Abbexa	EUR 411.00 EUR 592.00	0 1
Shipped within 5-10 working days.

Ribosomal Protein L35 (RPL35) Antibody
20-abx014125	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	0 1 2 3
Shipped within 5-10 working days.

Ribosomal Protein L35 (RPL35) Antibody
abx237434-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Ribosomal Protein L35 (RPL35) Antibody
20-abx328403	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Ribosomal Protein L35 (RPL35) Antibody
abx332720-100ul	Abbexa	100 ul	EUR 425.00
Shipped within 5-10 working days.

Rpl35 ORF Vector (Rat) (pORF)
ORF075560	ABM	1.0 ug DNA	EUR 506.00

RPL35 ORF Vector (Human) (pORF)
ORF008993	ABM	1.0 ug DNA	EUR 95.00

RPL35 ORF Vector (Human) (pORF)
ORF008994	ABM	1.0 ug DNA	EUR 95.00

Rpl35 ORF Vector (Mouse) (pORF)
ORF056353	ABM	1.0 ug DNA	EUR 506.00

Anti-RPL35/Ribosomal Protein L35 Antibody
A10561	BosterBio	100ul	EUR 397.00
Description: Rabbit Polyclonal RPL35/Ribosomal Protein L35 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Human 60S ribosomal protein L35 (RPL35)
1-CSB-RP041744h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	0 1 2 3 4 5
MW: 41.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S ribosomal protein L35(RPL35) expressed in E.coli

Rpl35 sgRNA CRISPR Lentivector set (Rat)
K7264701	ABM	3 x 1.0 ug	EUR 339.00

Rpl35 sgRNA CRISPR Lentivector set (Mouse)
K4466501	ABM	3 x 1.0 ug	EUR 339.00

RPL35 sgRNA CRISPR Lentivector set (Human)
K1973801	ABM	3 x 1.0 ug	EUR 339.00

Human Ribosomal Protein L35 (RPL35) ELISA Kit
abx382918-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Rpl35 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7264702	ABM	1.0 ug DNA	EUR 154.00

Rpl35 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7264703	ABM	1.0 ug DNA	EUR 154.00

Rpl35 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7264704	ABM	1.0 ug DNA	EUR 154.00

Rpl35 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4466502	ABM	1.0 ug DNA	EUR 154.00

Rpl35 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4466503	ABM	1.0 ug DNA	EUR 154.00

Rpl35 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4466504	ABM	1.0 ug DNA	EUR 154.00

RPL35 sgRNA CRISPR Lentivector (Human) (Target 1)
K1973802	ABM	1.0 ug DNA	EUR 154.00

RPL35 sgRNA CRISPR Lentivector (Human) (Target 2)
K1973803	ABM	1.0 ug DNA	EUR 154.00

RPL35 sgRNA CRISPR Lentivector (Human) (Target 3)
K1973804	ABM	1.0 ug DNA	EUR 154.00

RPL35 Ribosomal Protein L35 Human Recombinant Protein
PROTP42766	BosterBio	Regular: 10ug	EUR 317.00
Description: RPL35 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 146 amino acids (1-123 a.a) and having a molecular mass of 16.9kDa. RPL35 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RPL35 Protein Vector (Rat) (pPB-C-His)
PV302238	ABM	500 ng	EUR 603.00

RPL35 Protein Vector (Rat) (pPB-N-His)
PV302239	ABM	500 ng	EUR 603.00

RPL35 Protein Vector (Rat) (pPM-C-HA)
PV302240	ABM	500 ng	EUR 603.00

RPL35 Protein Vector (Rat) (pPM-C-His)
PV302241	ABM	500 ng	EUR 603.00

RPL35 Protein Vector (Human) (pPB-C-His)
PV035969	ABM	500 ng	EUR 329.00

RPL35 Protein Vector (Human) (pPB-N-His)
PV035970	ABM	500 ng	EUR 329.00

RPL35 Protein Vector (Human) (pPM-C-HA)
PV035971	ABM	500 ng	EUR 329.00

RPL35 Protein Vector (Human) (pPM-C-His)
PV035972	ABM	500 ng	EUR 329.00

RPL35 Protein Vector (Human) (pPB-C-His)
PV035973	ABM	500 ng	EUR 329.00

RPL35 Protein Vector (Human) (pPB-N-His)
PV035974	ABM	500 ng	EUR 329.00

RPL35 Protein Vector (Human) (pPM-C-HA)
PV035975	ABM	500 ng	EUR 329.00

RPL35 Protein Vector (Human) (pPM-C-His)
PV035976	ABM	500 ng	EUR 329.00

RPL35 Protein Vector (Mouse) (pPB-C-His)
PV225410	ABM	500 ng	EUR 603.00

RPL35 Protein Vector (Mouse) (pPB-N-His)
PV225411	ABM	500 ng	EUR 603.00

RPL35 Protein Vector (Mouse) (pPM-C-HA)
PV225412	ABM	500 ng	EUR 603.00