In den Nachrichten

RPL35

RPL35 Antibody

34357-100ul 100ul
EUR 252.00

RPL35 Antibody

34357-50ul 50ul
EUR 187.00

RPL35 Antibody

1-CSB-PA003990
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPL35. Recognizes RPL35 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

RPL35 Antibody

CSB-PA980122-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL35. Recognizes RPL35 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL35 Antibody

CSB-PA980122-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPL35. Recognizes RPL35 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPL35 Antibody

DF3709 200ul
EUR 304.00
Description: RPL35 Antibody detects endogenous levels of total RPL35.

RPL35 antibody

70R-50859 100 ul
EUR 244.00
Description: Purified Polyclonal RPL35 antibody

RPL35 antibody

70R-33955 100 ug
EUR 327.00
Description: Rabbit polyclonal RPL35 antibody

RPL35 siRNA

20-abx904664
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RPL35 siRNA

20-abx931964
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RPL35 siRNA

20-abx931965
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RPL35 Antibody

ABD13239 100 ug
EUR 438.00

RPL35 Antibody

ABD3709 100 ug
EUR 438.00

pOTB7-RPL35

PVT18263 2 ug
EUR 231.00

anti-RPL35

YF-PA25770 50 ul
EUR 334.00
Description: Mouse polyclonal to RPL35

RPL35 Blocking Peptide

DF3709-BP 1mg
EUR 195.00

RPL35 Blocking Peptide

20-abx063734
  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RPL35 Conjugated Antibody

C34357 100ul
EUR 397.00

RPL35 cloning plasmid

CSB-CL020247HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 372
  • Sequence: atggccaagatcaaggctcgagatcttcgcgggaagaagaaggaggagctgctgaaacagctggacgacctgaaggtggagctgtcccagctgcgcgtcgccaaagtgacaggcggtgcggcctccaagctctctaagatccgagtcgtccggaaatccattgcccgtgttctcac
  • Show more
Description: A cloning plasmid for the RPL35 gene.

RPL35 cloning plasmid

CSB-CL020247HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 372
  • Sequence: atggccaagatcaaggctcgagatcttcgcgggaagaagaaggaggagctgctgaaacagctggacgacctgaaggtggagctgtcccagctgcgcgtcgccaaagtgacaggcggtgcggcctccaagctctctaagatccgagtcgtccggaaatccattgcccgtgttctcac
  • Show more
Description: A cloning plasmid for the RPL35 gene.

RPL35 Rabbit pAb

A9043-100ul 100 ul
EUR 308.00

RPL35 Rabbit pAb

A9043-200ul 200 ul
EUR 459.00

RPL35 Rabbit pAb

A9043-20ul 20 ul Ask for price

RPL35 Rabbit pAb

A9043-50ul 50 ul Ask for price

RPL35 Polyclonal Antibody

ABP60252-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human RPL35 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RPL35 from Human, Mouse, Rat. This RPL35 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPL35 protein

RPL35 Polyclonal Antibody

ABP60252-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human RPL35 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RPL35 from Human, Mouse, Rat. This RPL35 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPL35 protein

RPL35 Polyclonal Antibody

ABP60252-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human RPL35 protein
  • Applications tips:
Description: A polyclonal antibody for detection of RPL35 from Human, Mouse, Rat. This RPL35 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RPL35 protein

anti- RPL35 antibody

FNab07434 100µg
EUR 548.75
  • Immunogen: ribosomal protein L35
  • Uniprot ID: P42766
  • Gene ID: 11224
  • Research Area: Metabolism
Description: Antibody raised against RPL35

RPL35 Polyclonal Antibody

ES8927-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against RPL35 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RPL35 Polyclonal Antibody

ES8927-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against RPL35 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-RPL35 antibody

PAab07434 100 ug
EUR 386.00

Anti-RPL35 antibody

STJ111539 100 µl
EUR 277.00
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L29P family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Anti-RPL35 antibody

STJ99645 200 µl
EUR 197.00
Description: Rabbit polyclonal to RPL35.

RPL35 protein (His tag)

80R-3971 20 ug
EUR 349.00
Description: Recombinant Human RPL35 protein

RPL35 ELISA KIT|Human

EF002591 96 Tests
EUR 689.00

Rat RPL35 shRNA Plasmid

20-abx988825
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse RPL35 shRNA Plasmid

20-abx975637
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human RPL35 shRNA Plasmid

20-abx957692
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RPL35 Recombinant Protein (Human)

RP026977 100 ug Ask for price

RPL35 Recombinant Protein (Human)

RP026980 100 ug Ask for price

RPL35 Recombinant Protein (Mouse)

RP169055 100 ug Ask for price

RPL35 Recombinant Protein (Rat)

RP226676 100 ug Ask for price

Ribosomal Protein L35 (RPL35) Antibody

20-abx008277
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Ribosomal Protein L35 (RPL35) Antibody

abx027115-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Ribosomal Protein L35 (RPL35) Antibody

abx027115-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Ribosomal Protein L35 (RPL35) Antibody

20-abx123478
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Ribosomal Protein L35 (RPL35) Antibody

20-abx014125
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Ribosomal Protein L35 (RPL35) Antibody

abx237434-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Ribosomal Protein L35 (RPL35) Antibody

20-abx328403
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Ribosomal Protein L35 (RPL35) Antibody

abx332720-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Rpl35 ORF Vector (Rat) (pORF)

ORF075560 1.0 ug DNA
EUR 506.00

RPL35 ORF Vector (Human) (pORF)

ORF008993 1.0 ug DNA
EUR 95.00

RPL35 ORF Vector (Human) (pORF)

ORF008994 1.0 ug DNA
EUR 95.00

Rpl35 ORF Vector (Mouse) (pORF)

ORF056353 1.0 ug DNA
EUR 506.00

Anti-RPL35/Ribosomal Protein L35 Antibody

A10561 100ul
EUR 397.00
Description: Rabbit Polyclonal RPL35/Ribosomal Protein L35 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Human 60S ribosomal protein L35 (RPL35)

1-CSB-RP041744h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 41.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S ribosomal protein L35(RPL35) expressed in E.coli

Rpl35 sgRNA CRISPR Lentivector set (Rat)

K7264701 3 x 1.0 ug
EUR 339.00

Rpl35 sgRNA CRISPR Lentivector set (Mouse)

K4466501 3 x 1.0 ug
EUR 339.00

RPL35 sgRNA CRISPR Lentivector set (Human)

K1973801 3 x 1.0 ug
EUR 339.00

Human Ribosomal Protein L35 (RPL35) ELISA Kit

abx382918-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Rpl35 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7264702 1.0 ug DNA
EUR 154.00

Rpl35 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7264703 1.0 ug DNA
EUR 154.00

Rpl35 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7264704 1.0 ug DNA
EUR 154.00

Rpl35 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4466502 1.0 ug DNA
EUR 154.00

Rpl35 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4466503 1.0 ug DNA
EUR 154.00

Rpl35 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4466504 1.0 ug DNA
EUR 154.00

RPL35 sgRNA CRISPR Lentivector (Human) (Target 1)

K1973802 1.0 ug DNA
EUR 154.00

RPL35 sgRNA CRISPR Lentivector (Human) (Target 2)

K1973803 1.0 ug DNA
EUR 154.00

RPL35 sgRNA CRISPR Lentivector (Human) (Target 3)

K1973804 1.0 ug DNA
EUR 154.00

RPL35 Ribosomal Protein L35 Human Recombinant Protein

PROTP42766 Regular: 10ug
EUR 317.00
Description: RPL35 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 146 amino acids (1-123 a.a) and having a molecular mass of 16.9kDa. RPL35 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RPL35 Protein Vector (Rat) (pPB-C-His)

PV302238 500 ng
EUR 603.00

RPL35 Protein Vector (Rat) (pPB-N-His)

PV302239 500 ng
EUR 603.00

RPL35 Protein Vector (Rat) (pPM-C-HA)

PV302240 500 ng
EUR 603.00

RPL35 Protein Vector (Rat) (pPM-C-His)

PV302241 500 ng
EUR 603.00

RPL35 Protein Vector (Human) (pPB-C-His)

PV035969 500 ng
EUR 329.00

RPL35 Protein Vector (Human) (pPB-N-His)

PV035970 500 ng
EUR 329.00

RPL35 Protein Vector (Human) (pPM-C-HA)

PV035971 500 ng
EUR 329.00

RPL35 Protein Vector (Human) (pPM-C-His)

PV035972 500 ng
EUR 329.00

RPL35 Protein Vector (Human) (pPB-C-His)

PV035973 500 ng
EUR 329.00

RPL35 Protein Vector (Human) (pPB-N-His)

PV035974 500 ng
EUR 329.00

RPL35 Protein Vector (Human) (pPM-C-HA)

PV035975 500 ng
EUR 329.00

RPL35 Protein Vector (Human) (pPM-C-His)

PV035976 500 ng
EUR 329.00

RPL35 Protein Vector (Mouse) (pPB-C-His)

PV225410 500 ng
EUR 603.00

RPL35 Protein Vector (Mouse) (pPB-N-His)

PV225411 500 ng
EUR 603.00

RPL35 Protein Vector (Mouse) (pPM-C-HA)

PV225412 500 ng
EUR 603.00