RPLP1 siRNA
20-abx904679	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RPLP1 Antibody
ABD9125	Lifescience Market	100 ug	EUR 438.00

RPLP1 antibody
39132-100ul	SAB	100ul	EUR 252.00

RPLP1 Antibody
42742-100ul	SAB	100ul	EUR 252.00

RPLP1 Antibody
DF9125	Affbiotech	200ul	EUR 304.00
Description: RPLP1 Antibody detects endogenous levels of total RPLP1.

RPLP1 siRNA
20-abx932003	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RPLP1 siRNA
20-abx932004	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RPLP1 Antibody
1-CSB-PA914244	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPLP1. Recognizes RPLP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

RPLP1 Antibody
1-CSB-PA327160	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPLP1. Recognizes RPLP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

RPLP1 Antibody
1-CSB-PA02364A0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPLP1. Recognizes RPLP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

anti-RPLP1
YF-PA14442	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to RPLP1

RPLP1 Conjugated Antibody
C39132	SAB	100ul	EUR 397.00

RPLP1 Conjugated Antibody
C42742	SAB	100ul	EUR 397.00

RPLP1 cloning plasmid
CSB-CL020340HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 345 Sequence: atggcctctgtctccgagctcgcctgcatctactcggccctcattctgcacgacgatgaggtgacagtcacggaggataagatcaatgccctcattaaagcagccggtgtaaatgttgagcctttttggcctggcttgtttgcaaaggccctggccaacgtcaacattgggagcct Show more
Description: A cloning plasmid for the RPLP1 gene.

anti- RPLP1 antibody
FNab07449	FN Test	100µg	EUR 585.00
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:100 Immunogen: ribosomal protein, large, P1 Uniprot ID: P05386 Gene ID: 6176 Research Area: Metabolism
Description: Antibody raised against RPLP1

RPLP1 Polyclonal Antibody
A52732	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

RPLP1 Rabbit pAb
A6725-100ul	Abclonal	100 ul	EUR 308.00

RPLP1 Rabbit pAb
A6725-200ul	Abclonal	200 ul	EUR 459.00

RPLP1 Rabbit pAb
A6725-20ul	Abclonal	20 ul	EUR 183.00

RPLP1 Rabbit pAb
A6725-50ul	Abclonal	50 ul	EUR 223.00

RPLP1 Blocking Peptide
DF9125-BP	Affbiotech	1mg	EUR 195.00

Anti-RPLP1 antibody
PAab07449	Lifescience Market	100 ug	EUR 412.00

pSV40- Rplp1- m
PVT11603	Lifescience Market	2 ug	EUR 273.00

pCMV-SPORT6-RPLP1
PVT12634	Lifescience Market	2 ug	EUR 391.00

Anti-RPLP1 antibody
STJ28808	St John's Laboratory	100 µl	EUR 277.00
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal phosphoprotein that is a component of the 60S subunit. The protein, which is a functional equivalent of the E. coli L7/L12 ribosomal protein, belongs to the L12P family of ribosomal proteins. It plays an important role in the elongation step of protein synthesis. Unlike most ribosomal proteins, which are basic, the encoded protein is acidic. Its C-terminal end is nearly identical to the C-terminal ends of the ribosomal phosphoproteins P0 and P2. The P1 protein can interact with P0 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Two alternatively spliced transcript variants that encode different proteins have been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Anti-RPLP1 (1G10)
YF-MA20412	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to RPLP1

Mouse RPLP1 shRNA Plasmid
20-abx974597	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat RPLP1 shRNA Plasmid
20-abx987508	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

RPLP1 ELISA KIT|Human
EF002607	Lifescience Market	96 Tests	EUR 689.00

Human RPLP1 shRNA Plasmid
20-abx954157	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

RPLP1 Antibody, HRP conjugated
1-CSB-PA02364B0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPLP1. Recognizes RPLP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPLP1 Antibody, FITC conjugated
1-CSB-PA02364C0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPLP1. Recognizes RPLP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPLP1 Antibody, Biotin conjugated
1-CSB-PA02364D0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPLP1. Recognizes RPLP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPLP1 Recombinant Protein (Human)
RP027049	ABM	100 ug	Ask for price

RPLP1 Recombinant Protein (Rat)
RP226736	ABM	100 ug	Ask for price

RPLP1 Recombinant Protein (Mouse)
RP169133	ABM	100 ug	Ask for price

RPLP1 Polyclonal Antibody, Biotin Conjugated
A52729	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

RPLP1 Polyclonal Antibody, FITC Conjugated
A52730	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

RPLP1 Polyclonal Antibody, HRP Conjugated
A52731	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

RPLP1 ORF Vector (Human) (pORF)
ORF009017	ABM	1.0 ug DNA	EUR 95.00

Rplp1 ORF Vector (Mouse) (pORF)
ORF056379	ABM	1.0 ug DNA	EUR 506.00

Rplp1 ORF Vector (Rat) (pORF)
ORF075580	ABM	1.0 ug DNA	EUR 506.00

RPLP1 sgRNA CRISPR Lentivector set (Human)
K1994701	ABM	3 x 1.0 ug	EUR 339.00

Rplp1 sgRNA CRISPR Lentivector set (Mouse)
K4649901	ABM	3 x 1.0 ug	EUR 339.00

Rplp1 sgRNA CRISPR Lentivector set (Rat)
K7068001	ABM	3 x 1.0 ug	EUR 339.00

RPLP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1994702	ABM	1.0 ug DNA	EUR 154.00

RPLP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1994703	ABM	1.0 ug DNA	EUR 154.00

RPLP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1994704	ABM	1.0 ug DNA	EUR 154.00

Rplp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4649902	ABM	1.0 ug DNA	EUR 154.00

Rplp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4649903	ABM	1.0 ug DNA	EUR 154.00

Rplp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4649904	ABM	1.0 ug DNA	EUR 154.00

Human 60S acidic ribosomal protein P1 (RPLP1)
1-CSB-EP020340HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	0 1 2 3 4 5
MW: 27.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S acidic ribosomal protein P1(RPLP1) expressed in E.coli

Rplp1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7068002	ABM	1.0 ug DNA	EUR 154.00

Rplp1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7068003	ABM	1.0 ug DNA	EUR 154.00

Rplp1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7068004	ABM	1.0 ug DNA	EUR 154.00

RPLP1 Ribosomal Phosphoprotein P1 Human Recombinant Protein
PROTP05386	BosterBio	Regular: 10ug	EUR 317.00
Description: RPLP1 is a full-length cDNA coding for the human ribosomal P1 phosphoprotein having a molecular mass of 12,336 Dalton (pH 4.75). RPLP1 protein is fused to a hexa-histidine purification tag.

RPLP1 Protein Vector (Human) (pPB-C-His)
PV036065	ABM	500 ng	EUR 329.00

RPLP1 Protein Vector (Human) (pPB-N-His)
PV036066	ABM	500 ng	EUR 329.00

RPLP1 Protein Vector (Human) (pPM-C-HA)
PV036067	ABM	500 ng	EUR 329.00

RPLP1 Protein Vector (Human) (pPM-C-His)
PV036068	ABM	500 ng	EUR 329.00

RPLP1 Protein Vector (Rat) (pPB-C-His)
PV302318	ABM	500 ng	EUR 603.00

RPLP1 Protein Vector (Rat) (pPB-N-His)
PV302319	ABM	500 ng	EUR 603.00

RPLP1 Protein Vector (Rat) (pPM-C-HA)
PV302320	ABM	500 ng	EUR 603.00

RPLP1 Protein Vector (Rat) (pPM-C-His)
PV302321	ABM	500 ng	EUR 603.00

RPLP1 Protein Vector (Mouse) (pPB-C-His)
PV225514	ABM	500 ng	EUR 603.00

RPLP1 Protein Vector (Mouse) (pPB-N-His)
PV225515	ABM	500 ng	EUR 603.00

RPLP1 Protein Vector (Mouse) (pPM-C-HA)
PV225516	ABM	500 ng	EUR 603.00

RPLP1 Protein Vector (Mouse) (pPM-C-His)
PV225517	ABM	500 ng	EUR 603.00

Rplp1 3'UTR GFP Stable Cell Line
TU168119	ABM	1.0 ml	Ask for price

RPLP1 3'UTR Luciferase Stable Cell Line
TU021628	ABM	1.0 ml	EUR 1394.00

Rplp1 3'UTR Luciferase Stable Cell Line
TU118119	ABM	1.0 ml	Ask for price

RPLP1 3'UTR GFP Stable Cell Line
TU071628	ABM	1.0 ml	EUR 1394.00

Rplp1 3'UTR Luciferase Stable Cell Line
TU219661	ABM	1.0 ml	Ask for price

Rplp1 3'UTR GFP Stable Cell Line
TU269661	ABM	1.0 ml	Ask for price

Ribosomal Protein Lateral Stalk Subunit P1 (RPLP1) Antibody
20-abx142202	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	0 1 2
Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P1 (RPLP1) Antibody
20-abx005158	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P1 (RPLP1) Antibody
20-abx214058	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P1 (RPLP1) Antibody
20-abx242311	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P1 (RPLP1) Antibody
abx237449-100ug	Abbexa	100 ug	EUR 551.00
Shipped within 5-12 working days.

RPLP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV676243	ABM	1.0 ug DNA	EUR 514.00

RPLP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV676247	ABM	1.0 ug DNA	EUR 514.00

RPLP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV676248	ABM	1.0 ug DNA	EUR 514.00

Rat 60S acidic ribosomal protein P1(RPLP1) ELISA kit
E02R0472-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S acidic ribosomal protein P1(RPLP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S acidic ribosomal protein P1(RPLP1) ELISA kit
E02R0472-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S acidic ribosomal protein P1(RPLP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S acidic ribosomal protein P1(RPLP1) ELISA kit
E02R0472-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S acidic ribosomal protein P1(RPLP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.