  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPLP1 Antibody

ABD9125 100 ug
EUR 438

RPLP1 antibody

39132-100ul 100ul
EUR 252

RPLP1 Antibody

42742-100ul 100ul
EUR 252

RPLP1 Antibody

DF9125 200ul
EUR 304
Description: RPLP1 Antibody detects endogenous levels of total RPLP1.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPLP1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPLP1. Recognizes RPLP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

RPLP1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RPLP1. Recognizes RPLP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

RPLP1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPLP1. Recognizes RPLP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200


YF-PA14442 50 ug
EUR 363
Description: Mouse polyclonal to RPLP1

RPLP1 Conjugated Antibody

C39132 100ul
EUR 397

RPLP1 Conjugated Antibody

C42742 100ul
EUR 397

RPLP1 cloning plasmid

CSB-CL020340HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 345
  • Sequence: atggcctctgtctccgagctcgcctgcatctactcggccctcattctgcacgacgatgaggtgacagtcacggaggataagatcaatgccctcattaaagcagccggtgtaaatgttgagcctttttggcctggcttgtttgcaaaggccctggccaacgtcaacattgggagcct
  • Show more
Description: A cloning plasmid for the RPLP1 gene.

anti- RPLP1 antibody

FNab07449 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: ribosomal protein, large, P1
  • Uniprot ID: P05386
  • Gene ID: 6176
  • Research Area: Metabolism
Description: Antibody raised against RPLP1

RPLP1 Polyclonal Antibody

A52732 100 µg
EUR 570.55
Description: Ask the seller for details

RPLP1 Rabbit pAb

A6725-100ul 100 ul
EUR 308

RPLP1 Rabbit pAb

A6725-200ul 200 ul
EUR 459

RPLP1 Rabbit pAb

A6725-20ul 20 ul
EUR 183

RPLP1 Rabbit pAb

A6725-50ul 50 ul
EUR 223

RPLP1 Blocking Peptide

DF9125-BP 1mg
EUR 195

Anti-RPLP1 antibody

PAab07449 100 ug
EUR 412

pSV40- Rplp1- m

PVT11603 2 ug
EUR 273


PVT12634 2 ug
EUR 391

Anti-RPLP1 antibody

STJ28808 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal phosphoprotein that is a component of the 60S subunit. The protein, which is a functional equivalent of the E. coli L7/L12 ribosomal protein, belongs to the L12P family of ribosomal proteins. It plays an important role in the elongation step of protein synthesis. Unlike most ribosomal proteins, which are basic, the encoded protein is acidic. Its C-terminal end is nearly identical to the C-terminal ends of the ribosomal phosphoproteins P0 and P2. The P1 protein can interact with P0 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Two alternatively spliced transcript variants that encode different proteins have been observed. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Anti-RPLP1 (1G10)

YF-MA20412 100 ug
EUR 363
Description: Mouse monoclonal to RPLP1

Mouse RPLP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RPLP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF002607 96 Tests
EUR 689

Human RPLP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPLP1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPLP1. Recognizes RPLP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPLP1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPLP1. Recognizes RPLP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPLP1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPLP1. Recognizes RPLP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPLP1 Recombinant Protein (Human)

RP027049 100 ug Ask for price

RPLP1 Recombinant Protein (Rat)

RP226736 100 ug Ask for price

RPLP1 Recombinant Protein (Mouse)

RP169133 100 ug Ask for price

RPLP1 Polyclonal Antibody, Biotin Conjugated

A52729 100 µg
EUR 570.55
Description: reagents widely cited

RPLP1 Polyclonal Antibody, FITC Conjugated

A52730 100 µg
EUR 570.55
Description: Ask the seller for details

RPLP1 Polyclonal Antibody, HRP Conjugated

A52731 100 µg
EUR 570.55
Description: The best epigenetics products

RPLP1 ORF Vector (Human) (pORF)

ORF009017 1.0 ug DNA
EUR 95

Rplp1 ORF Vector (Mouse) (pORF)

ORF056379 1.0 ug DNA
EUR 506

Rplp1 ORF Vector (Rat) (pORF)

ORF075580 1.0 ug DNA
EUR 506

RPLP1 sgRNA CRISPR Lentivector set (Human)

K1994701 3 x 1.0 ug
EUR 339

Rplp1 sgRNA CRISPR Lentivector set (Mouse)

K4649901 3 x 1.0 ug
EUR 339

Rplp1 sgRNA CRISPR Lentivector set (Rat)

K7068001 3 x 1.0 ug
EUR 339

RPLP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1994702 1.0 ug DNA
EUR 154

RPLP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1994703 1.0 ug DNA
EUR 154

RPLP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1994704 1.0 ug DNA
EUR 154

Rplp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4649902 1.0 ug DNA
EUR 154

Rplp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4649903 1.0 ug DNA
EUR 154

Rplp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4649904 1.0 ug DNA
EUR 154

Human 60S acidic ribosomal protein P1 (RPLP1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 27.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 60S acidic ribosomal protein P1(RPLP1) expressed in E.coli

Rplp1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7068002 1.0 ug DNA
EUR 154

Rplp1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7068003 1.0 ug DNA
EUR 154

Rplp1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7068004 1.0 ug DNA
EUR 154

RPLP1 Ribosomal Phosphoprotein P1 Human Recombinant Protein

PROTP05386 Regular: 10ug
EUR 317
Description: RPLP1 is a full-length cDNA coding for the human ribosomal P1 phosphoprotein having a molecular mass of 12,336 Dalton (pH 4.75). RPLP1 protein is fused to a hexa-histidine purification tag.

RPLP1 Protein Vector (Human) (pPB-C-His)

PV036065 500 ng
EUR 329

RPLP1 Protein Vector (Human) (pPB-N-His)

PV036066 500 ng
EUR 329

RPLP1 Protein Vector (Human) (pPM-C-HA)

PV036067 500 ng
EUR 329

RPLP1 Protein Vector (Human) (pPM-C-His)

PV036068 500 ng
EUR 329

RPLP1 Protein Vector (Rat) (pPB-C-His)

PV302318 500 ng
EUR 603

RPLP1 Protein Vector (Rat) (pPB-N-His)

PV302319 500 ng
EUR 603

RPLP1 Protein Vector (Rat) (pPM-C-HA)

PV302320 500 ng
EUR 603

RPLP1 Protein Vector (Rat) (pPM-C-His)

PV302321 500 ng
EUR 603

RPLP1 Protein Vector (Mouse) (pPB-C-His)

PV225514 500 ng
EUR 603

RPLP1 Protein Vector (Mouse) (pPB-N-His)

PV225515 500 ng
EUR 603

RPLP1 Protein Vector (Mouse) (pPM-C-HA)

PV225516 500 ng
EUR 603

RPLP1 Protein Vector (Mouse) (pPM-C-His)

PV225517 500 ng
EUR 603

Rplp1 3'UTR GFP Stable Cell Line

TU168119 1.0 ml Ask for price

RPLP1 3'UTR Luciferase Stable Cell Line

TU021628 1.0 ml
EUR 1394

Rplp1 3'UTR Luciferase Stable Cell Line

TU118119 1.0 ml Ask for price

RPLP1 3'UTR GFP Stable Cell Line

TU071628 1.0 ml
EUR 1394

Rplp1 3'UTR Luciferase Stable Cell Line

TU219661 1.0 ml Ask for price

Rplp1 3'UTR GFP Stable Cell Line

TU269661 1.0 ml Ask for price

Ribosomal Protein Lateral Stalk Subunit P1 (RPLP1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P1 (RPLP1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P1 (RPLP1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P1 (RPLP1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein Lateral Stalk Subunit P1 (RPLP1) Antibody

abx237449-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

RPLP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV676243 1.0 ug DNA
EUR 514

RPLP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV676247 1.0 ug DNA
EUR 514

RPLP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV676248 1.0 ug DNA
EUR 514

Rat 60S acidic ribosomal protein P1(RPLP1) ELISA kit

E02R0472-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S acidic ribosomal protein P1(RPLP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S acidic ribosomal protein P1(RPLP1) ELISA kit

E02R0472-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S acidic ribosomal protein P1(RPLP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 60S acidic ribosomal protein P1(RPLP1) ELISA kit

E02R0472-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 60S acidic ribosomal protein P1(RPLP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.