RPS11

RPS11 siRNA
20-abx904687	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RPS11 antibody
70R-33914	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal RPS11 antibody

RPS11 Antibody
ABD13241	Lifescience Market	100 ug	EUR 438.00

RPS11 Antibody
ABD3676	Lifescience Market	100 ug	EUR 438.00

RPS11 Antibody
34328-100ul	SAB	100ul	EUR 252.00

RPS11 Antibody
34328-50ul	SAB	50ul	EUR 187.00

RPS11 siRNA
20-abx932036	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RPS11 siRNA
20-abx932037	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RPS11 Antibody
DF3676	Affbiotech	200ul	EUR 304.00
Description: RPS11 Antibody detects endogenous levels of total RPS11.

RPS11 Antibody
CSB-PA163301-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against RPS11. Recognizes RPS11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPS11 Antibody
CSB-PA163301-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against RPS11. Recognizes RPS11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPS11 Antibody
1-CSB-PA040269	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPS11. Recognizes RPS11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RPS11 Antibody
1-CSB-PA01874A0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS11. Recognizes RPS11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RPS11 Conjugated Antibody
C34328	SAB	100ul	EUR 397.00

RPS11 cloning plasmid
CSB-CL020365HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 477 Sequence: atggcggacattcagactgagcgtgcctaccaaaagcagccgaccatctttcaaaacaagaagagggtcctgctgggagaaactggcaaggagaagctcccgcggtactacaagaacatcggtctgggcttcaagacacccaaggaggctattgagggcacctacattgacaagaa Show more
Description: A cloning plasmid for the RPS11 gene.

Anti-RPS11 Antibody
A07622	BosterBio	100ul	EUR 397.00
Description: Rabbit Polyclonal RPS11 Antibody. Validated in WB and tested in Human, Mouse, Rat.

RPS11 Polyclonal Antibody
A53308	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

RPS11 Blocking Peptide
DF3676-BP	Affbiotech	1mg	EUR 195.00

Mouse RPS11 shRNA Plasmid
20-abx973840	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat RPS11 shRNA Plasmid
20-abx986707	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Canine RPS11 ELISA KIT
ELI-38695d	Lifescience Market	96 Tests	EUR 928.00

Human RPS11 shRNA Plasmid
20-abx954179	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

RPS11 Antibody, HRP conjugated
1-CSB-PA01874B0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS11. Recognizes RPS11 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPS11 Antibody, FITC conjugated
1-CSB-PA01874C0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS11. Recognizes RPS11 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPS11 Antibody, Biotin conjugated
1-CSB-PA01874D0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS11. Recognizes RPS11 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPS11 Recombinant Protein (Human)
RP027094	ABM	100 ug	Ask for price

RPS11 Recombinant Protein (Rat)
RP226784	ABM	100 ug	Ask for price

RPS11 Recombinant Protein (Mouse)
RP169181	ABM	100 ug	Ask for price

Ribosomal Protein S11 (RPS11) Antibody
abx147725-100ug	Abbexa	100 ug	EUR 439.00
Shipped within 5-10 working days.

Ribosomal Protein S11 (RPS11) Antibody
20-abx328892	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Ribosomal Protein S11 (RPS11) Antibody
abx332722-100ul	Abbexa	100 ul	EUR 425.00
Shipped within 5-10 working days.

RPS11 Polyclonal Antibody, Biotin Conjugated
A53305	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

RPS11 Polyclonal Antibody, FITC Conjugated
A53306	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

RPS11 Polyclonal Antibody, HRP Conjugated
A53307	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

RPS11 ORF Vector (Human) (pORF)
ORF009032	ABM	1.0 ug DNA	EUR 95.00

Rps11 ORF Vector (Mouse) (pORF)
ORF056395	ABM	1.0 ug DNA	EUR 506.00

Rps11 ORF Vector (Rat) (pORF)
ORF075596	ABM	1.0 ug DNA	EUR 506.00

40S Ribosomal Protein S11 (RPS11) Antibody
20-abx109455	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

RPS11 sgRNA CRISPR Lentivector set (Human)
K2023501	ABM	3 x 1.0 ug	EUR 339.00

Rps11 sgRNA CRISPR Lentivector set (Mouse)
K4786301	ABM	3 x 1.0 ug	EUR 339.00

Human 40S ribosomal protein S11 (RPS11)
1-CSB-RP018744h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	0 1 2 3 4 5
MW: 45.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 40S ribosomal protein S11(RPS11) expressed in E.coli

Rps11 sgRNA CRISPR Lentivector set (Rat)
K7028101	ABM	3 x 1.0 ug	EUR 339.00

RPS11 sgRNA CRISPR Lentivector (Human) (Target 1)
K2023502	ABM	1.0 ug DNA	EUR 154.00

RPS11 sgRNA CRISPR Lentivector (Human) (Target 2)
K2023503	ABM	1.0 ug DNA	EUR 154.00

RPS11 sgRNA CRISPR Lentivector (Human) (Target 3)
K2023504	ABM	1.0 ug DNA	EUR 154.00

Rps11 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4786302	ABM	1.0 ug DNA	EUR 154.00

Rps11 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4786303	ABM	1.0 ug DNA	EUR 154.00

Rps11 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4786304	ABM	1.0 ug DNA	EUR 154.00

Rps11 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7028102	ABM	1.0 ug DNA	EUR 154.00

Rps11 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7028103	ABM	1.0 ug DNA	EUR 154.00

Rps11 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7028104	ABM	1.0 ug DNA	EUR 154.00

RPS11 Protein Vector (Human) (pPB-C-His)
PV036125	ABM	500 ng	EUR 329.00

RPS11 Protein Vector (Human) (pPB-N-His)
PV036126	ABM	500 ng	EUR 329.00

RPS11 Protein Vector (Human) (pPM-C-HA)
PV036127	ABM	500 ng	EUR 329.00

RPS11 Protein Vector (Human) (pPM-C-His)
PV036128	ABM	500 ng	EUR 329.00

RPS11 Protein Vector (Rat) (pPB-C-His)
PV302382	ABM	500 ng	EUR 603.00

RPS11 Protein Vector (Rat) (pPB-N-His)
PV302383	ABM	500 ng	EUR 603.00

RPS11 Protein Vector (Rat) (pPM-C-HA)
PV302384	ABM	500 ng	EUR 603.00

RPS11 Protein Vector (Rat) (pPM-C-His)
PV302385	ABM	500 ng	EUR 603.00

RPS11 Protein Vector (Mouse) (pPB-C-His)
PV225578	ABM	500 ng	EUR 603.00

RPS11 Protein Vector (Mouse) (pPB-N-His)
PV225579	ABM	500 ng	EUR 603.00

RPS11 Protein Vector (Mouse) (pPM-C-HA)
PV225580	ABM	500 ng	EUR 603.00

RPS11 Protein Vector (Mouse) (pPM-C-His)
PV225581	ABM	500 ng	EUR 603.00

Rps11 3'UTR GFP Stable Cell Line
TU168135	ABM	1.0 ml	Ask for price

RPS11 3'UTR Luciferase Stable Cell Line
TU021917	ABM	1.0 ml	EUR 2333.00

Rps11 3'UTR Luciferase Stable Cell Line
TU118135	ABM	1.0 ml	Ask for price

RPS11 3'UTR GFP Stable Cell Line
TU071917	ABM	1.0 ml	EUR 2333.00

Rps11 3'UTR Luciferase Stable Cell Line
TU219677	ABM	1.0 ml	Ask for price

Rps11 3'UTR GFP Stable Cell Line
TU269677	ABM	1.0 ml	Ask for price

Rat 40S ribosomal protein S11(RPS11) ELISA kit
E02R0124-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 40S ribosomal protein S11(RPS11) ELISA kit
E02R0124-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 40S ribosomal protein S11(RPS11) ELISA kit
E02R0124-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 40S ribosomal protein S11(RPS11) ELISA kit
E03R0124-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 40S ribosomal protein S11(RPS11) ELISA kit
E03R0124-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 40S ribosomal protein S11(RPS11) ELISA kit
E03R0124-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 40S ribosomal protein S11(RPS11) ELISA kit
E04R0124-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 40S ribosomal protein S11(RPS11) ELISA kit
E04R0124-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 40S ribosomal protein S11(RPS11) ELISA kit
E04R0124-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 40S ribosomal protein S11(RPS11) ELISA kit
E01R0124-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 40S ribosomal protein S11(RPS11) ELISA kit
E01R0124-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 40S ribosomal protein S11(RPS11) ELISA kit
E01R0124-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 40S ribosomal protein S11(RPS11) ELISA kit
E06R0124-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 40S ribosomal protein S11(RPS11) ELISA kit
E06R0124-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 40S ribosomal protein S11(RPS11) ELISA kit
E06R0124-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig 40S ribosomal protein S11(RPS11) ELISA kit
E07R0124-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.