RPS11

RPS11 Antibody

34328-100ul 100ul
EUR 252.00

RPS11 Antibody

34328-50ul 50ul
EUR 187.00

RPS11 Antibody

DF3676 200ul
EUR 304.00
Description: RPS11 Antibody detects endogenous levels of total RPS11.

RPS11 Antibody

1-CSB-PA040269
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RPS11. Recognizes RPS11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RPS11 Antibody

CSB-PA163301-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPS11. Recognizes RPS11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPS11 Antibody

CSB-PA163301-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RPS11. Recognizes RPS11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RPS11 antibody

70R-33914 100 ug
EUR 327.00
Description: Rabbit polyclonal RPS11 antibody

RPS11 Antibody

1-CSB-PA01874A0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS11. Recognizes RPS11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RPS11 siRNA

20-abx904687
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RPS11 siRNA

20-abx932036
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RPS11 siRNA

20-abx932037
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RPS11 Antibody

ABD13241 100 ug
EUR 438.00

RPS11 Antibody

ABD3676 100 ug
EUR 438.00

Anti-RPS11 Antibody

A07622 100ul
EUR 397.00
Description: Rabbit Polyclonal RPS11 Antibody. Validated in WB and tested in Human, Mouse, Rat.

RPS11 Blocking Peptide

DF3676-BP 1mg
EUR 195.00

RPS11 Conjugated Antibody

C34328 100ul
EUR 397.00

RPS11 cloning plasmid

CSB-CL020365HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 477
  • Sequence: atggcggacattcagactgagcgtgcctaccaaaagcagccgaccatctttcaaaacaagaagagggtcctgctgggagaaactggcaaggagaagctcccgcggtactacaagaacatcggtctgggcttcaagacacccaaggaggctattgagggcacctacattgacaagaa
  • Show more
Description: A cloning plasmid for the RPS11 gene.

RPS11 Polyclonal Antibody

A53308 100 µg
EUR 570.55
Description: Ask the seller for details

Mouse RPS11 shRNA Plasmid

20-abx973840
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat RPS11 shRNA Plasmid

20-abx986707
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RPS11 Antibody, HRP conjugated

1-CSB-PA01874B0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS11. Recognizes RPS11 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPS11 Antibody, FITC conjugated

1-CSB-PA01874C0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS11. Recognizes RPS11 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPS11 Antibody, Biotin conjugated

1-CSB-PA01874D0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPS11. Recognizes RPS11 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human RPS11 shRNA Plasmid

20-abx954179
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Canine RPS11 ELISA KIT

ELI-38695d 96 Tests
EUR 928.00

RPS11 Recombinant Protein (Human)

RP027094 100 ug Ask for price

RPS11 Recombinant Protein (Mouse)

RP169181 100 ug Ask for price

RPS11 Recombinant Protein (Rat)

RP226784 100 ug Ask for price

Ribosomal Protein S11 (RPS11) Antibody

abx147725-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

Ribosomal Protein S11 (RPS11) Antibody

20-abx328892
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Ribosomal Protein S11 (RPS11) Antibody

abx332722-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

RPS11 Polyclonal Antibody, Biotin Conjugated

A53305 100 µg
EUR 570.55
Description: reagents widely cited

RPS11 Polyclonal Antibody, FITC Conjugated

A53306 100 µg
EUR 570.55
Description: Ask the seller for details

RPS11 Polyclonal Antibody, HRP Conjugated

A53307 100 µg
EUR 570.55
Description: The best epigenetics products

Rps11 ORF Vector (Rat) (pORF)

ORF075596 1.0 ug DNA
EUR 506.00

RPS11 ORF Vector (Human) (pORF)

ORF009032 1.0 ug DNA
EUR 95.00

Rps11 ORF Vector (Mouse) (pORF)

ORF056395 1.0 ug DNA
EUR 506.00

Human 40S ribosomal protein S11 (RPS11)

1-CSB-RP018744h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 45.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 40S ribosomal protein S11(RPS11) expressed in E.coli

40S Ribosomal Protein S11 (RPS11) Antibody

20-abx109455
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Rps11 sgRNA CRISPR Lentivector set (Mouse)

K4786301 3 x 1.0 ug
EUR 339.00

Rps11 sgRNA CRISPR Lentivector set (Rat)

K7028101 3 x 1.0 ug
EUR 339.00

RPS11 sgRNA CRISPR Lentivector set (Human)

K2023501 3 x 1.0 ug
EUR 339.00

Rps11 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4786302 1.0 ug DNA
EUR 154.00

Rps11 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4786303 1.0 ug DNA
EUR 154.00

Rps11 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4786304 1.0 ug DNA
EUR 154.00

Rps11 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7028102 1.0 ug DNA
EUR 154.00

Rps11 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7028103 1.0 ug DNA
EUR 154.00

Rps11 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7028104 1.0 ug DNA
EUR 154.00

RPS11 sgRNA CRISPR Lentivector (Human) (Target 1)

K2023502 1.0 ug DNA
EUR 154.00

RPS11 sgRNA CRISPR Lentivector (Human) (Target 2)

K2023503 1.0 ug DNA
EUR 154.00

RPS11 sgRNA CRISPR Lentivector (Human) (Target 3)

K2023504 1.0 ug DNA
EUR 154.00

RPS11 Protein Vector (Rat) (pPB-C-His)

PV302382 500 ng
EUR 603.00

RPS11 Protein Vector (Rat) (pPB-N-His)

PV302383 500 ng
EUR 603.00

RPS11 Protein Vector (Rat) (pPM-C-HA)

PV302384 500 ng
EUR 603.00

RPS11 Protein Vector (Rat) (pPM-C-His)

PV302385 500 ng
EUR 603.00

RPS11 Protein Vector (Mouse) (pPB-C-His)

PV225578 500 ng
EUR 603.00

RPS11 Protein Vector (Mouse) (pPB-N-His)

PV225579 500 ng
EUR 603.00

RPS11 Protein Vector (Mouse) (pPM-C-HA)

PV225580 500 ng
EUR 603.00

RPS11 Protein Vector (Mouse) (pPM-C-His)

PV225581 500 ng
EUR 603.00

RPS11 Protein Vector (Human) (pPB-C-His)

PV036125 500 ng
EUR 329.00

RPS11 Protein Vector (Human) (pPB-N-His)

PV036126 500 ng
EUR 329.00

RPS11 Protein Vector (Human) (pPM-C-HA)

PV036127 500 ng
EUR 329.00

RPS11 Protein Vector (Human) (pPM-C-His)

PV036128 500 ng
EUR 329.00

Rps11 3'UTR Luciferase Stable Cell Line

TU118135 1.0 ml Ask for price

Rps11 3'UTR GFP Stable Cell Line

TU168135 1.0 ml Ask for price

Rps11 3'UTR Luciferase Stable Cell Line

TU219677 1.0 ml Ask for price

Rps11 3'UTR GFP Stable Cell Line

TU269677 1.0 ml Ask for price

RPS11 3'UTR GFP Stable Cell Line

TU071917 1.0 ml
EUR 2333.00

RPS11 3'UTR Luciferase Stable Cell Line

TU021917 1.0 ml
EUR 2333.00

Rabbit 40S ribosomal protein S11(RPS11) ELISA kit

E04R0124-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 40S ribosomal protein S11(RPS11) ELISA kit

E04R0124-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit 40S ribosomal protein S11(RPS11) ELISA kit

E04R0124-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 40S ribosomal protein S11(RPS11) ELISA kit

E02R0124-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 40S ribosomal protein S11(RPS11) ELISA kit

E02R0124-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat 40S ribosomal protein S11(RPS11) ELISA kit

E02R0124-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 40S ribosomal protein S11(RPS11) ELISA kit

E03R0124-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 40S ribosomal protein S11(RPS11) ELISA kit

E03R0124-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse 40S ribosomal protein S11(RPS11) ELISA kit

E03R0124-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 40S ribosomal protein S11(RPS11) ELISA kit

E01R0124-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 40S ribosomal protein S11(RPS11) ELISA kit

E01R0124-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human 40S ribosomal protein S11(RPS11) ELISA kit

E01R0124-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 40S ribosomal protein S11(RPS11) ELISA kit

E06R0124-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 40S ribosomal protein S11(RPS11) ELISA kit

E06R0124-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat 40S ribosomal protein S11(RPS11) ELISA kit

E06R0124-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog 40S ribosomal protein S11(RPS11) ELISA kit

E08R0124-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine 40S ribosomal protein S11(RPS11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.