RRAGA antibody
70R-15303 100 ug
EUR 327
Description: Rabbit polyclonal RRAGA antibody
RRAGA Antibody
40326-100ul 100ul
EUR 252
RRAGA Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RRAGA. Recognizes RRAGA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
RRAGA Antibody
DF7957 200ul
EUR 304
Description: RRAGA Antibody detects endogenous levels of total RRAGA.
RRAGA Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RRAGA. Recognizes RRAGA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:50-1:200, IF:1:50-1:500
RRAGA Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RRAGA. Recognizes RRAGA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RRAGA Antibody
ABD7957 100 ug
EUR 438
RRAGA/B Antibody
34965-100ul 100ul
EUR 252
RRAGA/B Antibody
34965-50ul 50ul
EUR 187
RRAGA antibody (HRP)
60R-1741 100 ug
EUR 327
Description: Rabbit polyclonal RRAGA antibody (HRP)
RRAGA antibody (FITC)
60R-1742 100 ug
EUR 327
Description: Rabbit polyclonal RRAGA antibody (FITC)
RRAGA antibody (biotin)
60R-1743 100 ug
EUR 327
Description: Rabbit polyclonal RRAGA antibody (biotin)
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RRAGA/RRAGB. Recognizes RRAGA/RRAGB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
RRAGA/B Antibody
DF4392 200ul
EUR 304
Description: RRAGA/B Antibody detects endogenous levels of total RRAGA/B.
RRAGA Blocking Peptide
DF7957-BP 1mg
EUR 195
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RRAGA/RRAGB. Recognizes RRAGA/RRAGB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
CSB-PA590465-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RRAGA/RRAGB. Recognizes RRAGA/RRAGB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
RRAGA / B Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
RRAGA Conjugated Antibody
C40326 100ul
EUR 397
RRAGA / RRAGB Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
RRAGA / RRAGB Antibody
abx332724-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
RRAGA cloning plasmid
CSB-CL752099HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 942
  • Sequence: atgccaaatacagccatgaagaaaaaggtgctgctgatggggaagagcgggtcggggaagaccagcatgaggtcgataatcttcgccaattacattgctcgcgacacccggcgcctgggggccaccattgacgtggaacactcccacgtccgattcctagggaacctggtgctgaa
  • Show more
Description: A cloning plasmid for the RRAGA gene.
RRAGA/B Antibody
ABD4392 100 ug
EUR 438
RRAGA Rabbit pAb
A7771-100ul 100 ul
EUR 308
RRAGA Rabbit pAb
A7771-200ul 200 ul
EUR 459
RRAGA Rabbit pAb
A7771-20ul 20 ul
EUR 183
RRAGA Rabbit pAb
A7771-50ul 50 ul
EUR 223
RRAGA Polyclonal Antibody
A51649 100 µg
EUR 570.55
Description: fast delivery possible
RRAGA Rabbit pAb
A15134-100ul 100 ul
EUR 308
RRAGA Rabbit pAb
A15134-200ul 200 ul
EUR 459
RRAGA Rabbit pAb
A15134-20ul 20 ul
EUR 183
RRAGA Rabbit pAb
A15134-50ul 50 ul
EUR 223
Anti-RRAGA antibody
STJ117328 100 µl
EUR 277
Anti-RRAGA antibody
STJ110082 100 µl
EUR 277
RRAGA/B Blocking Peptide
DF4392-BP 1mg
EUR 195
RRAGA Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RRAGA. Recognizes RRAGA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
RRAGA Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RRAGA. Recognizes RRAGA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
RRAGA Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RRAGA. Recognizes RRAGA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Mouse RRAGA shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat RRAGA shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RRAGA/B Conjugated Antibody
C34965 100ul
EUR 397
Human RRAGA shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RRAGA Recombinant Protein (Human)
RP027268 100 ug Ask for price
RRAGA Recombinant Protein (Mouse)
RP169343 100 ug Ask for price
RRAGA Recombinant Protein (Rat)
RP226928 100 ug Ask for price
RRAGA Polyclonal Antibody, HRP Conjugated
A51650 100 µg
EUR 570.55
Description: reagents widely cited
RRAGA Polyclonal Antibody, FITC Conjugated
A51651 100 µg
EUR 570.55
Description: Ask the seller for details
RRAGA Polyclonal Antibody, Biotin Conjugated
A51652 100 µg
EUR 570.55
Description: The best epigenetics products
Rraga ORF Vector (Rat) (pORF)
ORF075644 1.0 ug DNA
EUR 506
RRAGA ORF Vector (Human) (pORF)
ORF009090 1.0 ug DNA
EUR 95
Rraga ORF Vector (Mouse) (pORF)
ORF056449 1.0 ug DNA
EUR 506
RRAGA ELISA Kit (Mouse) (OKEH08550)
OKEH08550 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.099ng/mL
Polyclonal RRAGA Antibody - C-terminal region
AMR09780G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RRAGA - C-terminal region. This antibody is tested and proven to work in the following applications:
Rraga sgRNA CRISPR Lentivector set (Mouse)
K4959501 3 x 1.0 ug
EUR 339
Rraga sgRNA CRISPR Lentivector set (Rat)
K6989501 3 x 1.0 ug
EUR 339
RRAGA sgRNA CRISPR Lentivector set (Human)
K2070001 3 x 1.0 ug
EUR 339
Ras Related GTP Binding A (RRAGA) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ras Related GTP Binding A (RRAGA) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ras Related GTP Binding A (RRAGA) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rraga sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4959502 1.0 ug DNA
EUR 154
Rraga sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4959503 1.0 ug DNA
EUR 154
Rraga sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4959504 1.0 ug DNA
EUR 154
Rraga sgRNA CRISPR Lentivector (Rat) (Target 1)
K6989502 1.0 ug DNA
EUR 154
Rraga sgRNA CRISPR Lentivector (Rat) (Target 2)
K6989503 1.0 ug DNA
EUR 154
Rraga sgRNA CRISPR Lentivector (Rat) (Target 3)
K6989504 1.0 ug DNA
EUR 154
RRAGA sgRNA CRISPR Lentivector (Human) (Target 1)
K2070002 1.0 ug DNA
EUR 154
RRAGA sgRNA CRISPR Lentivector (Human) (Target 2)
K2070003 1.0 ug DNA
EUR 154
RRAGA sgRNA CRISPR Lentivector (Human) (Target 3)
K2070004 1.0 ug DNA
EUR 154
RRAGA 3'UTR Luciferase Stable Cell Line
TU022381 1.0 ml
EUR 1394
Rraga 3'UTR Luciferase Stable Cell Line
TU118184 1.0 ml Ask for price
Rraga 3'UTR GFP Stable Cell Line
TU168184 1.0 ml Ask for price
Rraga 3'UTR Luciferase Stable Cell Line
TU219726 1.0 ml Ask for price
Rraga 3'UTR GFP Stable Cell Line
TU269726 1.0 ml Ask for price
RRAGA 3'UTR GFP Stable Cell Line
TU072381 1.0 ml
EUR 1394
RRAGA Protein Vector (Rat) (pPB-C-His)
PV302574 500 ng
EUR 603
RRAGA Protein Vector (Rat) (pPB-N-His)
PV302575 500 ng
EUR 603
RRAGA Protein Vector (Rat) (pPM-C-HA)
PV302576 500 ng
EUR 603
RRAGA Protein Vector (Rat) (pPM-C-His)
PV302577 500 ng
EUR 603
RRAGA Protein Vector (Mouse) (pPB-C-His)
PV225794 500 ng
EUR 603
RRAGA Protein Vector (Mouse) (pPB-N-His)
PV225795 500 ng
EUR 603
RRAGA Protein Vector (Mouse) (pPM-C-HA)
PV225796 500 ng
EUR 603
RRAGA Protein Vector (Mouse) (pPM-C-His)
PV225797 500 ng
EUR 603