  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SEC13 Protein
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
SEC13 antibody
70R-20140 50 ul
EUR 435.00
Description: Rabbit polyclonal SEC13 antibody
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SEC13 Antibody
DF12734 200ul
EUR 304.00
Description: SEC13 Antibody detects endogenous levels of SEC13.
SEC13 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SEC13. Recognizes SEC13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
Mouse Protein SEC13 homolog, Sec13 ELISA KIT
ELI-15465m 96 Tests
EUR 865.00
Bovine Protein SEC13 homolog, SEC13 ELISA KIT
ELI-40987b 96 Tests
EUR 928.00
Human Protein SEC13 homolog, SEC13 ELISA KIT
ELI-42376h 96 Tests
EUR 824.00
SEC13 cloning plasmid
CSB-CL020934HU-10ug 10ug
EUR 381.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 969
  • Sequence: atggtgtcagtaattaacactgtggatacctcccatgaggacatgattcacgacgcccagatggactactatggcacccgcctggcaacctgctcatcagacaggtccgtcaaaatctttgatgtgcgcaatggagggcagatccttatcgccgacctcaggggtcatgagggtcc
  • Show more
Description: A cloning plasmid for the SEC13 gene.
anti- SEC13 antibody
FNab07677 100µg
EUR 548.75
  • Immunogen: SEC13 homolog(S. cerevisiae)
  • Uniprot ID: P55735
  • Gene ID: 6396
  • Research Area: Metabolism
Description: Antibody raised against SEC13
SEC13 Rabbit pAb
A11613-100ul 100 ul
EUR 308.00
SEC13 Rabbit pAb
A11613-200ul 200 ul
EUR 459.00
SEC13 Rabbit pAb
A11613-20ul 20 ul
EUR 183.00
SEC13 Rabbit pAb
A11613-50ul 50 ul
EUR 223.00
Recombinant Human SEC13
7-06343 5µg Ask for price
Recombinant Human SEC13
7-06344 20µg Ask for price
Recombinant Human SEC13
7-06345 1mg Ask for price
SEC13 Polyclonal Antibody
27544-100ul 100ul
EUR 252.00
SEC13 Polyclonal Antibody
27544-50ul 50ul
EUR 187.00
SEC13 Blocking Peptide
DF12734-BP 1mg
EUR 195.00
Anti-SEC13 antibody
PAab07677 100 ug
EUR 386.00
Anti-SEC13 antibody
STJ113218 100 µl
EUR 277.00
Description: The protein encoded by this gene belongs to the SEC13 family of WD-repeat proteins. It is a constituent of the endoplasmic reticulum and the nuclear pore complex. It has similarity to the yeast SEC13 protein, which is required for vesicle biogenesis from endoplasmic reticulum during the transport of proteins. Multiple alternatively spliced transcript variants have been found.
Polyclonal SEC13 Antibody (Center)
AMM08682G 0.1ml
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SEC13 (Center). This antibody is tested and proven to work in the following applications:
SEC13 Polyclonal Conjugated Antibody
C27544 100ul
EUR 397.00
Mouse SEC13 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Rat SEC13 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
EF002785 96 Tests
EUR 689.00
Human SEC13 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
SEC13 protein (His tag)
80R-1766 100 ug
EUR 305.00
Description: Purified recombinant Human SEC13 protein
SEC13 Recombinant Protein (Human)
RP027880 100 ug Ask for price
SEC13 Recombinant Protein (Rat)
RP227858 100 ug Ask for price
SEC13 Recombinant Protein (Mouse)
RP170504 100 ug Ask for price
SEC13 Human Recombinant Protein
PROTP55735 Regular: 20ug
EUR 317.00
Description: SEC13 Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 342 amino acids (1-322 a.a.) and having a molecular mass of 37.7kDa. ;The SEC13 is purified by proprietary chromatographic techniques.
SEC13 Homolog, Nuclear Pore And COPII Coat Complex Component (SEC13) Antibody
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SEC13 Homolog, Nuclear Pore And COPII Coat Complex Component (SEC13) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
SEC13 Homolog, Nuclear Pore And COPII Coat Complex Component (SEC13) Antibody
abx025879-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
SEC13 Homolog, Nuclear Pore And COPII Coat Complex Component (SEC13) Antibody
abx025879-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
SEC13 Homolog, Nuclear Pore And COPII Coat Complex Component (SEC13) Antibody
abx237677-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
Sec13 Homolog (S. Cerevisiae) Antibody
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SEC13 protein isoform 1 antibody
22162-100ul 100ul
EUR 390.00
SEC13 ORF Vector (Human) (pORF)
ORF009294 1.0 ug DNA
EUR 95.00
Sec13 ORF Vector (Mouse) (pORF)
ORF056836 1.0 ug DNA
EUR 506.00
Sec13 ORF Vector (Rat) (pORF)
ORF075954 1.0 ug DNA
EUR 506.00
Human SEC13 Homolog, Nuclear Pore And COPII Coat Complex Component (SEC13) ELISA Kit
abx383083-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.
Polyclonal SEC13 Antibody - C-terminal region
AMM07737G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SEC13 - C-terminal region. This antibody is tested and proven to work in the following applications:
SEC13 sgRNA CRISPR Lentivector set (Human)
K2112101 3 x 1.0 ug
EUR 339.00
Sec13 sgRNA CRISPR Lentivector set (Mouse)
K3470501 3 x 1.0 ug
EUR 339.00
Sec13 sgRNA CRISPR Lentivector set (Rat)
K7207401 3 x 1.0 ug
EUR 339.00
SEC13 sgRNA CRISPR Lentivector (Human) (Target 1)
K2112102 1.0 ug DNA
EUR 154.00
SEC13 sgRNA CRISPR Lentivector (Human) (Target 2)
K2112103 1.0 ug DNA
EUR 154.00
SEC13 sgRNA CRISPR Lentivector (Human) (Target 3)
K2112104 1.0 ug DNA
EUR 154.00
Sec13 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3470502 1.0 ug DNA
EUR 154.00
Sec13 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3470503 1.0 ug DNA
EUR 154.00
Sec13 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3470504 1.0 ug DNA
EUR 154.00
Sec13 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7207402 1.0 ug DNA
EUR 154.00
Sec13 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7207403 1.0 ug DNA
EUR 154.00
Sec13 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7207404 1.0 ug DNA
EUR 154.00
SEC13 Protein Vector (Human) (pPB-C-His)
PV037173 500 ng
EUR 329.00
SEC13 Protein Vector (Human) (pPB-N-His)
PV037174 500 ng
EUR 329.00
SEC13 Protein Vector (Human) (pPM-C-HA)
PV037175 500 ng
EUR 329.00
SEC13 Protein Vector (Human) (pPM-C-His)
PV037176 500 ng
EUR 329.00
Recombinant Human SEC13 Protein, His, E.coli-1mg
QP13445-1mg 1mg
EUR 2757.00
Recombinant Human SEC13 Protein, His, E.coli-20ug
QP13445-20ug 20ug
EUR 201.00
Recombinant Human SEC13 Protein, His, E.coli-5ug
QP13445-5ug 5ug
EUR 155.00
SEC13 Protein Vector (Rat) (pPB-C-His)
PV303814 500 ng
EUR 603.00
SEC13 Protein Vector (Rat) (pPB-N-His)
PV303815 500 ng
EUR 603.00
SEC13 Protein Vector (Rat) (pPM-C-HA)
PV303816 500 ng
EUR 603.00
SEC13 Protein Vector (Rat) (pPM-C-His)
PV303817 500 ng
EUR 603.00
SEC13 Protein Vector (Mouse) (pPB-C-His)
PV227342 500 ng
EUR 603.00
SEC13 Protein Vector (Mouse) (pPB-N-His)
PV227343 500 ng
EUR 603.00
SEC13 Protein Vector (Mouse) (pPM-C-HA)
PV227344 500 ng
EUR 603.00
SEC13 Protein Vector (Mouse) (pPM-C-His)
PV227345 500 ng
EUR 603.00
Sec13 3'UTR GFP Stable Cell Line
TU168486 1.0 ml Ask for price
SEC13 3'UTR Luciferase Stable Cell Line
TU022824 1.0 ml
EUR 4617.00
Sec13 3'UTR Luciferase Stable Cell Line
TU118486 1.0 ml Ask for price
SEC13 3'UTR GFP Stable Cell Line
TU072824 1.0 ml
EUR 4617.00
Sec13 3'UTR Luciferase Stable Cell Line
TU220049 1.0 ml Ask for price
Sec13 3'UTR GFP Stable Cell Line
TU270049 1.0 ml Ask for price
SEC13 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV660805 1.0 ug DNA
EUR 514.00
SEC13 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV660809 1.0 ug DNA
EUR 514.00
SEC13 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV660810 1.0 ug DNA
EUR 514.00
Recombinant Pichia pastoris SEC13 Protein (aa 1-289)
VAng-Cr6672-1mgEcoli 1 mg (E. coli)
EUR 4037.00
Description: Pichia pastoris (strain GS115 / ATCC 20864) Protein transport protein SEC13 (SEC13), recombinant protein.
Recombinant Pichia pastoris SEC13 Protein (aa 1-289)
VAng-Cr6672-500gEcoli 500 µg (E. coli)
EUR 2854.00
Description: Pichia pastoris (strain GS115 / ATCC 20864) Protein transport protein SEC13 (SEC13), recombinant protein.