SEC63

Translocation Protein SEC63 Homolog (SEC63) Antibody
20-abx115406	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

SEC63 antibody
70R-1765	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal SEC63 antibody

SEC63 antibody
70R-20149	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SEC63 antibody

SEC63 Antibody
DF12471	Affbiotech	200ul	EUR 304
Description: SEC63 antibody detects endogenous levels of SEC63.

SEC63 antibody
70R-6862	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SEC63 antibody

SEC63 Antibody
1-CSB-PA020961GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SEC63. Recognizes SEC63 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SEC63 siRNA
20-abx932794	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SEC63 siRNA
20-abx932795	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-SEC63
YF-PA17531	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to SEC63

Human Translocation protein SEC63 (SEC63) ELISA Kit
abx383092-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Translocation protein SEC63 homolog, SEC63 ELISA KIT
ELI-53221h	Lifescience Market	96 Tests	EUR 824

Mouse Translocation protein SEC63 homolog, Sec63 ELISA KIT
ELI-41598m	Lifescience Market	96 Tests	EUR 865

SEC63 Blocking Peptide
33R-10039	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SEC63 antibody, catalog no. 70R-1765

SEC63 Blocking Peptide
33R-9989	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SEC63 antibody, catalog no. 70R-6862

SEC63 Blocking Peptide
DF12471-BP	Affbiotech	1mg	EUR 195

SEC63 cloning plasmid
CSB-CL890681HU1-10ug	Cusabio	10ug	EUR 749
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2283 Sequence: atggccgggcagcagttccagtacgatgacagtgggaacaccttcttctacttcctcacctccttcgtggggctcatcgtgatcccggcgacatactacctctggccccgagatcagaatgccgagcaaattcgattaaagaatatcagaaaagtatatggaaggtgtatgtggt Show more
Description: A cloning plasmid for the SEC63 gene.

SEC63 cloning plasmid
CSB-CL890681HU2-10ug	Cusabio	10ug	EUR 749
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2283 Sequence: atggccgggcagcagttccagtacgatgacagtgggaacaccttcttctacttcctcacctccttcgtggggctcatcgtgatcccggcgacatactacctctggccccgagatcagaatgccgagcaaattcgattaaagaatatcagaaaagtatatggaaggtgtatgtggt Show more
Description: A cloning plasmid for the SEC63 gene.

anti- SEC63 antibody
FNab07693	FN Test	100µg	EUR 548.75
Immunogen: SEC63 homolog(S. cerevisiae) Uniprot ID: Q9UGP8 Gene ID: 11231 Research Area: Metabolism
Description: Antibody raised against SEC63

Anti-SEC63 antibody
PAab07693	Lifescience Market	100 ug	EUR 386

Anti-SEC63 (1A8)
YF-MA17686	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SEC63

Canine SEC63 ELISA KIT
ELI-18333d	Lifescience Market	96 Tests	EUR 928

SEC63 ELISA KIT|Human
EF002798	Lifescience Market	96 Tests	EUR 689

Human SEC63 shRNA Plasmid
20-abx957697	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse SEC63 shRNA Plasmid
20-abx980267	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SEC63 Recombinant Protein (Human)
RP027928	ABM	100 ug	Ask for price

SEC63 Recombinant Protein (Human)
RP027931	ABM	100 ug	Ask for price

SEC63 Recombinant Protein (Rat)
RP227930	ABM	100 ug	Ask for price

SEC63 Recombinant Protein (Mouse)
RP170609	ABM	100 ug	Ask for price

Sec63 ORF Vector (Rat) (pORF)
ORF075978	ABM	1.0 ug DNA	EUR 506

SEC63 ORF Vector (Human) (pORF)
ORF009310	ABM	1.0 ug DNA	EUR 95

SEC63 ORF Vector (Human) (pORF)
ORF009311	ABM	1.0 ug DNA	EUR 95

Sec63 ORF Vector (Mouse) (pORF)
ORF056871	ABM	1.0 ug DNA	EUR 506

Sec63 sgRNA CRISPR Lentivector set (Mouse)
K4769501	ABM	3 x 1.0 ug	EUR 339

Sec63 sgRNA CRISPR Lentivector set (Rat)
K6460801	ABM	3 x 1.0 ug	EUR 339

SEC63 sgRNA CRISPR Lentivector set (Human)
K2114601	ABM	3 x 1.0 ug	EUR 339

Recombinant human Translocation protein SEC63 homolog
P2236	FN Test	100ug	Ask for price
Uniprot ID: Q9UGP8 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Translocation protein SEC63 homolog

Sec63 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4769502	ABM	1.0 ug DNA	EUR 154

Sec63 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4769503	ABM	1.0 ug DNA	EUR 154

Sec63 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4769504	ABM	1.0 ug DNA	EUR 154

Sec63 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6460802	ABM	1.0 ug DNA	EUR 154

Sec63 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6460803	ABM	1.0 ug DNA	EUR 154

Sec63 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6460804	ABM	1.0 ug DNA	EUR 154

SEC63 sgRNA CRISPR Lentivector (Human) (Target 1)
K2114602	ABM	1.0 ug DNA	EUR 154

SEC63 sgRNA CRISPR Lentivector (Human) (Target 2)
K2114603	ABM	1.0 ug DNA	EUR 154

SEC63 sgRNA CRISPR Lentivector (Human) (Target 3)
K2114604	ABM	1.0 ug DNA	EUR 154

SEC63 Protein Vector (Rat) (pPB-C-His)
PV303910	ABM	500 ng	EUR 1191

SEC63 Protein Vector (Rat) (pPB-N-His)
PV303911	ABM	500 ng	EUR 1191

SEC63 Protein Vector (Rat) (pPM-C-HA)
PV303912	ABM	500 ng	EUR 1191

SEC63 Protein Vector (Rat) (pPM-C-His)
PV303913	ABM	500 ng	EUR 1191

SEC63 Protein Vector (Mouse) (pPB-C-His)
PV227482	ABM	500 ng	EUR 1065

SEC63 Protein Vector (Mouse) (pPB-N-His)
PV227483	ABM	500 ng	EUR 1065

SEC63 Protein Vector (Mouse) (pPM-C-HA)
PV227484	ABM	500 ng	EUR 1065

SEC63 Protein Vector (Mouse) (pPM-C-His)
PV227485	ABM	500 ng	EUR 1065

SEC63 Protein Vector (Human) (pPB-C-His)
PV037237	ABM	500 ng	EUR 329

SEC63 Protein Vector (Human) (pPB-N-His)
PV037238	ABM	500 ng	EUR 329

SEC63 Protein Vector (Human) (pPM-C-HA)
PV037239	ABM	500 ng	EUR 329

SEC63 Protein Vector (Human) (pPM-C-His)
PV037240	ABM	500 ng	EUR 329

SEC63 Protein Vector (Human) (pPB-C-His)
PV037241	ABM	500 ng	EUR 329

SEC63 Protein Vector (Human) (pPB-N-His)
PV037242	ABM	500 ng	EUR 329

SEC63 Protein Vector (Human) (pPM-C-HA)
PV037243	ABM	500 ng	EUR 329

SEC63 Protein Vector (Human) (pPM-C-His)
PV037244	ABM	500 ng	EUR 329

Sec63 3'UTR Luciferase Stable Cell Line
TU118511	ABM	1.0 ml	Ask for price

Sec63 3'UTR GFP Stable Cell Line
TU168511	ABM	1.0 ml	Ask for price

Sec63 3'UTR Luciferase Stable Cell Line
TU220074	ABM	1.0 ml	Ask for price

Sec63 3'UTR GFP Stable Cell Line
TU270074	ABM	1.0 ml	Ask for price

SEC63 3'UTR GFP Stable Cell Line
TU072849	ABM	1.0 ml	EUR 2333

SEC63 3'UTR Luciferase Stable Cell Line
TU022849	ABM	1.0 ml	EUR 2333

SEC63 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV714861	ABM	1.0 ug DNA	EUR 316

SEC63 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV714865	ABM	1.0 ug DNA	EUR 316

SEC63 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV714866	ABM	1.0 ug DNA	EUR 316

Sec63 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4769505	ABM	3 x 1.0 ug	EUR 376

Sec63 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6460805	ABM	3 x 1.0 ug	EUR 376

SEC63 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2114605	ABM	3 x 1.0 ug	EUR 376

Sec63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4769506	ABM	1.0 ug DNA	EUR 167

Sec63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4769507	ABM	1.0 ug DNA	EUR 167

Sec63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4769508	ABM	1.0 ug DNA	EUR 167

SEC63 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV714862	ABM	1.0 ug DNA	EUR 316

SEC63 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV714863	ABM	1.0 ug DNA	EUR 374

SEC63 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV714864	ABM	1.0 ug DNA	EUR 374

Sec63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6460806	ABM	1.0 ug DNA	EUR 167

Sec63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6460807	ABM	1.0 ug DNA	EUR 167

Sec63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6460808	ABM	1.0 ug DNA	EUR 167

SEC63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2114606	ABM	1.0 ug DNA	EUR 167

SEC63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2114607	ABM	1.0 ug DNA	EUR 167

SEC63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2114608	ABM	1.0 ug DNA	EUR 167