Translocation Protein SEC63 Homolog (SEC63) Antibody
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SEC63 antibody
70R-1765 100 ug
EUR 377.00
Description: Rabbit polyclonal SEC63 antibody
SEC63 antibody
70R-20149 50 ul
EUR 435.00
Description: Rabbit polyclonal SEC63 antibody
SEC63 Antibody
DF12471 200ul
EUR 304.00
Description: SEC63 antibody detects endogenous levels of SEC63.
SEC63 antibody
70R-6862 50 ug
EUR 467.00
Description: Rabbit polyclonal SEC63 antibody
SEC63 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SEC63. Recognizes SEC63 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
YF-PA17531 50 ug
EUR 363.00
Description: Mouse polyclonal to SEC63
Human Translocation protein SEC63 (SEC63) ELISA Kit
abx383092-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.
Human Translocation protein SEC63 homolog, SEC63 ELISA KIT
ELI-53221h 96 Tests
EUR 824.00
Mouse Translocation protein SEC63 homolog, Sec63 ELISA KIT
ELI-41598m 96 Tests
EUR 865.00
SEC63 Blocking Peptide
33R-10039 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SEC63 antibody, catalog no. 70R-1765
SEC63 Blocking Peptide
33R-9989 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SEC63 antibody, catalog no. 70R-6862
SEC63 Blocking Peptide
DF12471-BP 1mg
EUR 195.00
SEC63 cloning plasmid
CSB-CL890681HU1-10ug 10ug
EUR 749.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2283
  • Sequence: atggccgggcagcagttccagtacgatgacagtgggaacaccttcttctacttcctcacctccttcgtggggctcatcgtgatcccggcgacatactacctctggccccgagatcagaatgccgagcaaattcgattaaagaatatcagaaaagtatatggaaggtgtatgtggt
  • Show more
Description: A cloning plasmid for the SEC63 gene.
SEC63 cloning plasmid
CSB-CL890681HU2-10ug 10ug
EUR 749.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2283
  • Sequence: atggccgggcagcagttccagtacgatgacagtgggaacaccttcttctacttcctcacctccttcgtggggctcatcgtgatcccggcgacatactacctctggccccgagatcagaatgccgagcaaattcgattaaagaatatcagaaaagtatatggaaggtgtatgtggt
  • Show more
Description: A cloning plasmid for the SEC63 gene.
anti- SEC63 antibody
FNab07693 100µg
EUR 548.75
  • Immunogen: SEC63 homolog(S. cerevisiae)
  • Uniprot ID: Q9UGP8
  • Gene ID: 11231
  • Research Area: Metabolism
Description: Antibody raised against SEC63
Anti-SEC63 antibody
PAab07693 100 ug
EUR 386.00
Anti-SEC63 (1A8)
YF-MA17686 100 ug
EUR 363.00
Description: Mouse monoclonal to SEC63
ELI-18333d 96 Tests
EUR 928.00
EF002798 96 Tests
EUR 689.00
Human SEC63 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse SEC63 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
SEC63 Recombinant Protein (Human)
RP027928 100 ug Ask for price
SEC63 Recombinant Protein (Human)
RP027931 100 ug Ask for price
SEC63 Recombinant Protein (Rat)
RP227930 100 ug Ask for price
SEC63 Recombinant Protein (Mouse)
RP170609 100 ug Ask for price
Sec63 ORF Vector (Rat) (pORF)
ORF075978 1.0 ug DNA
EUR 506.00
SEC63 ORF Vector (Human) (pORF)
ORF009310 1.0 ug DNA
EUR 95.00
SEC63 ORF Vector (Human) (pORF)
ORF009311 1.0 ug DNA
EUR 95.00
Sec63 ORF Vector (Mouse) (pORF)
ORF056871 1.0 ug DNA
EUR 506.00
Sec63 sgRNA CRISPR Lentivector set (Mouse)
K4769501 3 x 1.0 ug
EUR 339.00
Sec63 sgRNA CRISPR Lentivector set (Rat)
K6460801 3 x 1.0 ug
EUR 339.00
SEC63 sgRNA CRISPR Lentivector set (Human)
K2114601 3 x 1.0 ug
EUR 339.00
Recombinant human Translocation protein SEC63 homolog
P2236 100ug Ask for price
  • Uniprot ID: Q9UGP8
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Translocation protein SEC63 homolog
Sec63 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4769502 1.0 ug DNA
EUR 154.00
Sec63 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4769503 1.0 ug DNA
EUR 154.00
Sec63 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4769504 1.0 ug DNA
EUR 154.00
Sec63 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6460802 1.0 ug DNA
EUR 154.00
Sec63 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6460803 1.0 ug DNA
EUR 154.00
Sec63 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6460804 1.0 ug DNA
EUR 154.00
SEC63 sgRNA CRISPR Lentivector (Human) (Target 1)
K2114602 1.0 ug DNA
EUR 154.00
SEC63 sgRNA CRISPR Lentivector (Human) (Target 2)
K2114603 1.0 ug DNA
EUR 154.00
SEC63 sgRNA CRISPR Lentivector (Human) (Target 3)
K2114604 1.0 ug DNA
EUR 154.00
SEC63 Protein Vector (Rat) (pPB-C-His)
PV303910 500 ng
EUR 1191.00
SEC63 Protein Vector (Rat) (pPB-N-His)
PV303911 500 ng
EUR 1191.00
SEC63 Protein Vector (Rat) (pPM-C-HA)
PV303912 500 ng
EUR 1191.00
SEC63 Protein Vector (Rat) (pPM-C-His)
PV303913 500 ng
EUR 1191.00
SEC63 Protein Vector (Mouse) (pPB-C-His)
PV227482 500 ng
EUR 1065.00
SEC63 Protein Vector (Mouse) (pPB-N-His)
PV227483 500 ng
EUR 1065.00
SEC63 Protein Vector (Mouse) (pPM-C-HA)
PV227484 500 ng
EUR 1065.00
SEC63 Protein Vector (Mouse) (pPM-C-His)
PV227485 500 ng
EUR 1065.00
SEC63 Protein Vector (Human) (pPB-C-His)
PV037237 500 ng
EUR 329.00
SEC63 Protein Vector (Human) (pPB-N-His)
PV037238 500 ng
EUR 329.00
SEC63 Protein Vector (Human) (pPM-C-HA)
PV037239 500 ng
EUR 329.00
SEC63 Protein Vector (Human) (pPM-C-His)
PV037240 500 ng
EUR 329.00
SEC63 Protein Vector (Human) (pPB-C-His)
PV037241 500 ng
EUR 329.00
SEC63 Protein Vector (Human) (pPB-N-His)
PV037242 500 ng
EUR 329.00
SEC63 Protein Vector (Human) (pPM-C-HA)
PV037243 500 ng
EUR 329.00
SEC63 Protein Vector (Human) (pPM-C-His)
PV037244 500 ng
EUR 329.00
Sec63 3'UTR Luciferase Stable Cell Line
TU118511 1.0 ml Ask for price
Sec63 3'UTR GFP Stable Cell Line
TU168511 1.0 ml Ask for price
Sec63 3'UTR Luciferase Stable Cell Line
TU220074 1.0 ml Ask for price
Sec63 3'UTR GFP Stable Cell Line
TU270074 1.0 ml Ask for price
SEC63 3'UTR GFP Stable Cell Line
TU072849 1.0 ml
EUR 2333.00
SEC63 3'UTR Luciferase Stable Cell Line
TU022849 1.0 ml
EUR 2333.00
SEC63 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV714861 1.0 ug DNA
EUR 316.00
SEC63 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV714865 1.0 ug DNA
EUR 316.00
SEC63 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV714866 1.0 ug DNA
EUR 316.00
Sec63 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4769505 3 x 1.0 ug
EUR 376.00
Sec63 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6460805 3 x 1.0 ug
EUR 376.00
SEC63 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2114605 3 x 1.0 ug
EUR 376.00
Sec63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4769506 1.0 ug DNA
EUR 167.00
Sec63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4769507 1.0 ug DNA
EUR 167.00
Sec63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4769508 1.0 ug DNA
EUR 167.00
SEC63 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV714862 1.0 ug DNA
EUR 316.00
SEC63 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV714863 1.0 ug DNA
EUR 374.00
SEC63 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV714864 1.0 ug DNA
EUR 374.00
Sec63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6460806 1.0 ug DNA
EUR 167.00
Sec63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6460807 1.0 ug DNA
EUR 167.00
Sec63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6460808 1.0 ug DNA
EUR 167.00
SEC63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2114606 1.0 ug DNA
EUR 167.00
SEC63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2114607 1.0 ug DNA
EUR 167.00
SEC63 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2114608 1.0 ug DNA
EUR 167.00