In den Nachrichten


SENP5 antibody
70R-30806 100 ug
EUR 327.00
Description: Rabbit polyclonal SENP5 antibody
SENP5 Antibody
33521-100ul 100ul
EUR 252.00
SENP5 Antibody
33521-50ul 50ul
EUR 187.00
SENP5 Antibody
43328-100ul 100ul
EUR 252.00
SENP5 Antibody
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SENP5. Recognizes SENP5 from Human, Mouse, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
SENP5 Antibody
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SENP5. Recognizes SENP5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
SENP5 Antibody
CSB-PA911693-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SENP5. Recognizes SENP5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
SENP5 Antibody
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SENP5. Recognizes SENP5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
SENP5 antibody
70R-3795 50 ug
EUR 467.00
Description: Rabbit polyclonal SENP5 antibody raised against the middle region of SENP5
SENP5 antibody
70R-51212 100 ul
EUR 244.00
Description: Purified Polyclonal SENP5 antibody
SENP5 Antibody
AF0276 200ul
EUR 304.00
Description: SENP5 antibody detects endogenous levels of total SENP5.
SENP5 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SENP5. Recognizes SENP5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SENP5 Antibody
ABF0276 100 ug
EUR 438.00
PVT17289 2 ug
EUR 258.00
YF-PA26973 50 ul
EUR 334.00
Description: Mouse polyclonal to SENP5
Anti-SENP5 Antibody
A08574 100ul
EUR 397.00
Description: Rabbit Polyclonal SENP5 Antibody. Validated in IHC, WB and tested in Human, Mouse.
SENP5 Blocking Peptide
33R-5426 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SENP5 antibody, catalog no. 70R-3795
SENP5 Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SENP5-Specific Antibody
abx237714-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
SENP5 Blocking Peptide
AF0276-BP 1mg
EUR 195.00
SENP5 Conjugated Antibody
C43328 100ul
EUR 397.00
SENP5 Conjugated Antibody
C33521 100ul
EUR 397.00
SENP5 cloning plasmid
CSB-CL846632HU-10ug 10ug
EUR 474.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2268
  • Sequence: atgaaaaaacagaggaaaattctatggaggaaaggaatccacttagccttttctgagaaatggaatactgggtttggaggctttaagaagttttattttcaccaacacttgtgcattctgaaagctaagctgggaaggccagttacttggaatagacagttgagacatttccagg
  • Show more
Description: A cloning plasmid for the SENP5 gene.
SENP5 Polyclonal Antibody
ABP52421-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SENP5 at AA range: 620-700
  • Applications tips:
Description: A polyclonal antibody for detection of SENP5 from Human, Mouse, Monkey. This SENP5 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SENP5 at AA range: 620-700
SENP5 Polyclonal Antibody
ABP52421-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SENP5 at AA range: 620-700
  • Applications tips:
Description: A polyclonal antibody for detection of SENP5 from Human, Mouse, Monkey. This SENP5 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SENP5 at AA range: 620-700
SENP5 Polyclonal Antibody
ABP52421-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SENP5 at AA range: 620-700
  • Applications tips:
Description: A polyclonal antibody for detection of SENP5 from Human, Mouse, Monkey. This SENP5 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SENP5 at AA range: 620-700
SENP5 Polyclonal Antibody
ES3420-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against SENP5 from Human/Mouse/Monkey. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
SENP5 Polyclonal Antibody
ES3420-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against SENP5 from Human/Mouse/Monkey. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
Anti-SENP5 antibody
STJ95604 200 µl
EUR 197.00
Description: Rabbit polyclonal to SENP5.
Anti-SENP5 (3C2)
YF-MA20028 100 ug
EUR 363.00
Description: Mouse monoclonal to SENP5
EF002817 96 Tests
EUR 689.00
Human SENP5 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
abx595536-96tests 96 tests
EUR 637.00
  • Shipped within 1-2 weeks.
Mouse SENP5 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
anti- SENP5-Specific antibody
FNab07714 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: SUMO1/sentrin specific peptidase 5
  • Uniprot ID: Q96HI0
  • Research Area: Metabolism
Description: Antibody raised against SENP5-Specific
Anti-SENP5-Specific antibody
PAab07714 100 ug
EUR 386.00
pWPXLd-Flag-SENP5 Plasmid
PVTB01086-4a 2 ug
EUR 356.00
SENP5 Recombinant Protein (Human)
RP028018 100 ug Ask for price
SENP5 Recombinant Protein (Mouse)
RP170777 100 ug Ask for price
SENP5 ORF Vector (Human) (pORF)
ORF009340 1.0 ug DNA
EUR 95.00
Senp5 ORF Vector (Mouse) (pORF)
ORF056927 1.0 ug DNA
EUR 506.00
SENP5 Colorimetric Cell-Based ELISA Kit
EKC1513 100ul
EUR 572.00
Senp5 sgRNA CRISPR Lentivector set (Mouse)
K4948601 3 x 1.0 ug
EUR 339.00
SENP5 sgRNA CRISPR Lentivector set (Human)
K2118801 3 x 1.0 ug
EUR 339.00
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
abx026768-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
abx026768-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
abx028031-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
abx028031-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Sumo1/Sentrin Specific Peptidase 5 (SENP5) Antibody
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
abx331610-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Senp5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4948602 1.0 ug DNA
EUR 154.00
Senp5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4948603 1.0 ug DNA
EUR 154.00
Senp5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4948604 1.0 ug DNA
EUR 154.00
SENP5 sgRNA CRISPR Lentivector (Human) (Target 1)
K2118802 1.0 ug DNA
EUR 154.00
SENP5 sgRNA CRISPR Lentivector (Human) (Target 2)
K2118803 1.0 ug DNA
EUR 154.00
SENP5 sgRNA CRISPR Lentivector (Human) (Target 3)
K2118804 1.0 ug DNA
EUR 154.00
SENP5 Protein Vector (Mouse) (pPB-C-His)
PV227706 500 ng
EUR 1065.00
SENP5 Protein Vector (Mouse) (pPB-N-His)
PV227707 500 ng
EUR 1065.00
SENP5 Protein Vector (Mouse) (pPM-C-HA)
PV227708 500 ng
EUR 1065.00
SENP5 Protein Vector (Mouse) (pPM-C-His)
PV227709 500 ng
EUR 1065.00
SENP5 Protein Vector (Human) (pPB-C-His)
PV037357 500 ng
EUR 329.00
SENP5 Protein Vector (Human) (pPB-N-His)
PV037358 500 ng
EUR 329.00
SENP5 Protein Vector (Human) (pPM-C-HA)
PV037359 500 ng
EUR 329.00
SENP5 Protein Vector (Human) (pPM-C-His)
PV037360 500 ng
EUR 329.00
pPLK/GFP+Puro-SENP5 shRNA-1 Plasmid
PVTB01086-3a 2 ug
EUR 356.00
pPLK/GFP+Puro-SENP5 shRNA-2 Plasmid
PVTB01086-3b 2 ug
EUR 356.00
pPLK/GFP+Puro-SENP5 shRNA-3 Plasmid
PVTB01086-3c 2 ug
EUR 356.00
Senp5 3'UTR Luciferase Stable Cell Line
TU118551 1.0 ml Ask for price
Senp5 3'UTR GFP Stable Cell Line
TU168551 1.0 ml Ask for price
Senp5 3'UTR Luciferase Stable Cell Line
TU220120 1.0 ml Ask for price
Senp5 3'UTR GFP Stable Cell Line
TU270120 1.0 ml Ask for price
SENP5 3'UTR GFP Stable Cell Line
TU072892 1.0 ml
EUR 2333.00
SENP5 3'UTR Luciferase Stable Cell Line
TU022892 1.0 ml
EUR 2333.00
SENP5 Colorimetric Cell-Based ELISA Kit (OKAG01025)
OKAG01025 96 Wells
EUR 596.00
Description: Description of target: ;Species reactivity: Human, Mouse;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:
Mouse Sentrin- specific protease 5, Senp5 ELISA KIT
ELI-29715m 96 Tests
EUR 865.00
Human Sentrin- specific protease 5, SENP5 ELISA KIT
ELI-30406h 96 Tests
EUR 824.00
Human SUMO1/Sentrin Specific Peptidase 5 (SENP5) ELISA Kit
abx383105-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.
Sentrin/SUMO-specific protease 5 (SENP5, MGC27076) polyclonal antibody
ABP-PAB-10336 100 ug Ask for price
    • Product line: Proteases
    • Brand: