SENP5 Antibody
ABF0276 100 ug
EUR 438
SENP5 antibody
70R-51212 100 ul
EUR 244
Description: Purified Polyclonal SENP5 antibody
SENP5 antibody
70R-3795 50 ug
EUR 467
Description: Rabbit polyclonal SENP5 antibody raised against the middle region of SENP5
SENP5 antibody
70R-21685 50 ul
EUR 435
Description: Rabbit polyclonal SENP5 antibody
SENP5 antibody
70R-30806 100 ug
EUR 327
Description: Rabbit polyclonal SENP5 antibody
SENP5 Antibody
33521-100ul 100ul
EUR 252
SENP5 Antibody
33521-50ul 50ul
EUR 187
SENP5 Antibody
43328-100ul 100ul
EUR 252
SENP5 siRNA
20-abx932875
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SENP5 siRNA
20-abx932876
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SENP5 Antibody
CSB-PA911693-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SENP5. Recognizes SENP5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
SENP5 Antibody
CSB-PA911693-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SENP5. Recognizes SENP5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
SENP5 Antibody
1-CSB-PA993187
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SENP5. Recognizes SENP5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
SENP5 Antibody
1-CSB-PA004063
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SENP5. Recognizes SENP5 from Human, Mouse, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
SENP5 Antibody
1-CSB-PA021011GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SENP5. Recognizes SENP5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
pBlueScriptR-SENP5
PVT17289 2 ug
EUR 258
anti-SENP5
YF-PA26973 50 ul
EUR 334
Description: Mouse polyclonal to SENP5
SENP5 Conjugated Antibody
C43328 100ul
EUR 397
SENP5 Conjugated Antibody
C33521 100ul
EUR 397
SENP5 Blocking Peptide
AF0276-BP 1mg
EUR 195
SENP5 Polyclonal Antibody
ES3420-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SENP5 from Human/Mouse/Monkey. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
SENP5 Polyclonal Antibody
ES3420-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SENP5 from Human/Mouse/Monkey. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
SENP5 Blocking Peptide
20-abx064087
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
SENP5 Polyclonal Antibody
ABP52421-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SENP5 at AA range: 620-700
  • Applications tips:
Description: A polyclonal antibody for detection of SENP5 from Human, Mouse, Monkey. This SENP5 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SENP5 at AA range: 620-700
SENP5 Polyclonal Antibody
ABP52421-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SENP5 at AA range: 620-700
  • Applications tips:
Description: A polyclonal antibody for detection of SENP5 from Human, Mouse, Monkey. This SENP5 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SENP5 at AA range: 620-700
SENP5 Polyclonal Antibody
ABP52421-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SENP5 at AA range: 620-700
  • Applications tips:
Description: A polyclonal antibody for detection of SENP5 from Human, Mouse, Monkey. This SENP5 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SENP5 at AA range: 620-700
SENP5-Specific Antibody
abx237714-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Anti-SENP5 Antibody
A08574 100ul
EUR 397
Description: Rabbit Polyclonal SENP5 Antibody. Validated in IHC, WB and tested in Human, Mouse.
SENP5 Blocking Peptide
33R-5426 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SENP5 antibody, catalog no. 70R-3795
SENP5 cloning plasmid
CSB-CL846632HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2268
  • Sequence: atgaaaaaacagaggaaaattctatggaggaaaggaatccacttagccttttctgagaaatggaatactgggtttggaggctttaagaagttttattttcaccaacacttgtgcattctgaaagctaagctgggaaggccagttacttggaatagacagttgagacatttccagg
  • Show more
Description: A cloning plasmid for the SENP5 gene.
Anti-SENP5 antibody
STJ95604 200 µl
EUR 197
Description: Rabbit polyclonal to SENP5.
Anti-SENP5 (3C2)
YF-MA20028 100 ug
EUR 363
Description: Mouse monoclonal to SENP5
SENP5 Cell ELISA Kit
abx595536-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.
Mouse SENP5 shRNA Plasmid
20-abx983373
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SENP5 ELISA KIT|Human
EF002817 96 Tests
EUR 689
anti- SENP5-Specific antibody
FNab07714 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: SUMO1/sentrin specific peptidase 5
  • Uniprot ID: Q96HI0
  • Research Area: Metabolism
Description: Antibody raised against SENP5-Specific
Human SENP5 shRNA Plasmid
20-abx966359
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-SENP5-Specific antibody
PAab07714 100 ug
EUR 386
SENP5 Recombinant Protein (Human)
RP028018 100 ug Ask for price
SENP5 Recombinant Protein (Mouse)
RP170777 100 ug Ask for price
pWPXLd-Flag-SENP5 Plasmid
PVTB01086-4a 2 ug
EUR 356
SENP5 ORF Vector (Human) (pORF)
ORF009340 1.0 ug DNA
EUR 95
Senp5 ORF Vector (Mouse) (pORF)
ORF056927 1.0 ug DNA
EUR 506
SENP5 Colorimetric Cell-Based ELISA Kit
EKC1513 100ul
EUR 572
SENP5 sgRNA CRISPR Lentivector set (Human)
K2118801 3 x 1.0 ug
EUR 339
Senp5 sgRNA CRISPR Lentivector set (Mouse)
K4948601 3 x 1.0 ug
EUR 339
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
20-abx124054
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Sumo1/Sentrin Specific Peptidase 5 (SENP5) Antibody
20-abx115898
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
20-abx013229
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
20-abx007928
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
abx026768-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
abx026768-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
abx028031-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
abx028031-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
20-abx326309
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
abx331610-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
SUMO1/Sentrin Specific Peptidase 5 (SENP5) Antibody
20-abx213493
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
SENP5 sgRNA CRISPR Lentivector (Human) (Target 1)
K2118802 1.0 ug DNA
EUR 154
SENP5 sgRNA CRISPR Lentivector (Human) (Target 2)
K2118803 1.0 ug DNA
EUR 154
SENP5 sgRNA CRISPR Lentivector (Human) (Target 3)
K2118804 1.0 ug DNA
EUR 154
Senp5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4948602 1.0 ug DNA
EUR 154
Senp5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4948603 1.0 ug DNA
EUR 154
Senp5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4948604 1.0 ug DNA
EUR 154
SENP5 Protein Vector (Human) (pPB-C-His)
PV037357 500 ng
EUR 329
SENP5 Protein Vector (Human) (pPB-N-His)
PV037358 500 ng
EUR 329
SENP5 Protein Vector (Human) (pPM-C-HA)
PV037359 500 ng
EUR 329
SENP5 Protein Vector (Human) (pPM-C-His)
PV037360 500 ng
EUR 329
pPLK/GFP+Puro-SENP5 shRNA-1 Plasmid
PVTB01086-3a 2 ug
EUR 356
pPLK/GFP+Puro-SENP5 shRNA-2 Plasmid
PVTB01086-3b 2 ug
EUR 356
pPLK/GFP+Puro-SENP5 shRNA-3 Plasmid
PVTB01086-3c 2 ug
EUR 356
SENP5 Protein Vector (Mouse) (pPB-C-His)
PV227706 500 ng
EUR 1065
SENP5 Protein Vector (Mouse) (pPB-N-His)
PV227707 500 ng
EUR 1065
SENP5 Protein Vector (Mouse) (pPM-C-HA)
PV227708 500 ng
EUR 1065
SENP5 Protein Vector (Mouse) (pPM-C-His)
PV227709 500 ng
EUR 1065
Senp5 3'UTR GFP Stable Cell Line
TU168551 1.0 ml Ask for price
SENP5 3'UTR Luciferase Stable Cell Line
TU022892 1.0 ml
EUR 2333
Senp5 3'UTR Luciferase Stable Cell Line
TU118551 1.0 ml Ask for price
SENP5 3'UTR GFP Stable Cell Line
TU072892 1.0 ml
EUR 2333
Senp5 3'UTR Luciferase Stable Cell Line
TU220120 1.0 ml Ask for price
Senp5 3'UTR GFP Stable Cell Line
TU270120 1.0 ml Ask for price
SENP5 Colorimetric Cell-Based ELISA Kit (OKAG01025)
OKAG01025 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:
Mouse Sentrin- specific protease 5, Senp5 ELISA KIT
ELI-29715m 96 Tests
EUR 865
Human Sentrin- specific protease 5, SENP5 ELISA KIT
ELI-30406h 96 Tests
EUR 824
Sentrin/SUMO-specific protease 5 (SENP5, MGC27076) polyclonal antibody
ABP-PAB-10336 100 ug Ask for price
    • Product line: Proteases
    • Brand:
Sentrin/SUMO-specific protease 5 (SENP5, MGC27076) polyclonal antibody
ABP-PAB-10337 100 ug Ask for price
    • Product line: Proteases
    • Brand: