SFTPD

SFTPD Antibody
35929-100ul	SAB	100ul	EUR 252.00

SFTPD Antibody
1-CSB-PA924520	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SFTPD. Recognizes SFTPD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

SFTPD Antibody
1-CSB-PA820032	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SFTPD. Recognizes SFTPD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

SFTPD antibody
70R-5911	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal SFTPD antibody raised against the middle region of SFTPD

SFTPD Antibody
1-CSB-PA021175GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SFTPD. Recognizes SFTPD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

SFTPD siRNA
20-abx904892	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

SFTPD siRNA
20-abx933134	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

SFTPD siRNA
20-abx933135	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

SFTPD Blocking Peptide
33R-7253	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SFTPD antibody, catalog no. 70R-5911

SFTPD, human recombinant
7328-100	Biovision		EUR 387.00

SFTPD Conjugated Antibody
C35929	SAB	100ul	EUR 397.00

SFTPD cloning plasmid
CSB-CL021175HU-10ug	Cusabio	10ug	EUR 426.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1128 Sequence: atgctgctcttcctcctctctgcactggtcctgctcacacagcccctgggctacctggaagcaggaatgaagacctactcccacagaacaatgcccagtgcttgcaccctggtcatgtgtagctcagtggagagtggcctgcctggtcgcgatggacgggatgggagagagggcc Show more
Description: A cloning plasmid for the SFTPD gene.

SFTPD Rabbit pAb
A1651-100ul	Abclonal	100 ul	EUR 308.00

SFTPD Rabbit pAb
A1651-200ul	Abclonal	200 ul	EUR 459.00

SFTPD Rabbit pAb
A1651-20ul	Abclonal	20 ul	EUR 183.00

SFTPD Rabbit pAb
A1651-50ul	Abclonal	50 ul	EUR 223.00

SFTPD Polyclonal Antibody
ABP60380-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from part region of human SFTPD protein at amino acid sequence of 290-370 Applications tips:
Description: A polyclonal antibody for detection of SFTPD from Human, Mouse, Rat. This SFTPD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SFTPD protein at amino acid sequence of 290-370

SFTPD Polyclonal Antibody
ABP60380-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from part region of human SFTPD protein at amino acid sequence of 290-370 Applications tips:
Description: A polyclonal antibody for detection of SFTPD from Human, Mouse, Rat. This SFTPD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SFTPD protein at amino acid sequence of 290-370

SFTPD Polyclonal Antibody
ABP60380-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from part region of human SFTPD protein at amino acid sequence of 290-370 Applications tips:
Description: A polyclonal antibody for detection of SFTPD from Human, Mouse, Rat. This SFTPD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SFTPD protein at amino acid sequence of 290-370

SFTPD Polyclonal Antibody
ES10072-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against SFTPD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SFTPD Polyclonal Antibody
ES10072-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against SFTPD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-SFTPD antibody
STJ116154	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene is part of the innate immune response, protecting the lungs against inhaled microorganisms and chemicals. The encoded protein may also be involved in surfactant metabolism.

Anti-SFTPD antibody
STJ191230	St John's Laboratory	200 µl	EUR 197.00
Description: Unconjugated Rabbit polyclonal to SFTPD

SFTPD protein (His tag)
80R-3864	Fitzgerald	100 ug	EUR 327.00
Description: Purified recombinant SFTPD protein (His tag)

Human SFTPD ELISA Kit
ELA-E1039h	Lifescience Market	96 Tests	EUR 824.00

Mouse Sftpd ELISA Kit
ELI-03347m	Lifescience Market	96 Tests	EUR 865.00

Mouse SFTPD shRNA Plasmid
20-abx972661	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat SFTPD shRNA Plasmid
20-abx984952	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human SFTPD shRNA Plasmid
20-abx954352	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

SFTPD Recombinant Protein (Human)
RP028354	ABM	100 ug	Ask for price

SFTPD Recombinant Protein (Rat)
RP228419	ABM	100 ug	Ask for price

SFTPD Recombinant Protein (Mouse)
RP171410	ABM	100 ug	Ask for price

Polyclonal SFTPD Antibody (C-term)
AMR09891G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFTPD (C-term). This antibody is tested and proven to work in the following applications:

Surfactant Protein D (SFTPD) Antibody
abx027729-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Surfactant Protein D (SFTPD) Antibody
abx027729-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Surfactant Protein D (SFTPD) Antibody
20-abx115918	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

Surfactant Protein D (SFTPD) Antibody
abx238401-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Surfactant Protein D (SFTPD) Antibody
abx414524-025mg	Abbexa	0.25 mg	EUR 592.00
Shipped within 1 week.

Surfactant Protein D (SFTPD) Antibody
20-abx339748	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Surfactant Protein D (SFTPD) Antibody
20-abx339749	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Sftpd ORF Vector (Rat) (pORF)
ORF076141	ABM	1.0 ug DNA	EUR 506.00

SFTPD ORF Vector (Human) (pORF)
ORF009452	ABM	1.0 ug DNA	EUR 95.00

Sftpd ORF Vector (Mouse) (pORF)
ORF057138	ABM	1.0 ug DNA	EUR 506.00

SFTPD ELISA Kit (Mouse) (OKAN05034)
OKAN05034	Aviva Systems Biology	96 Wells	EUR 792.00
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12.7 pg/mL

SFTPD ELISA Kit (Rat) (OKAN06602)
OKAN06602	Aviva Systems Biology	96 Wells	EUR 792.00
Description: Description of target: binds carbohydrates; may play a role in defense response in the lung [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.1 pg/mL

SFTPD ELISA Kit (Human) (OKCD07083)
OKCD07083	Aviva Systems Biology	96 Wells	EUR 609.00
Description: Description of target: SFTPD contributes to the lung's defense against inhaled microorganisms. SFTPD may participate in the extracellular reorganization or turnover of pulmonary surfactant. SFTPD binds strongly maltose residues and to a lesser extent other alpha-glucosyl moieti;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.233ng/mL

SFTPD ELISA Kit (Mouse) (OKCD07084)
OKCD07084	Aviva Systems Biology	96 Wells	EUR 701.00
Description: Description of target: Surfactant, pulmonary-associated protein D, also known as SFTPD or SP-D, is a protein which in humans is encoded by the SFTPD gene. By fluorescence in situ hybridization, the SP-D gene was localized in 10q22.2-q23.1. On the basis of homology with other collectins, potential functions for SP-D include roles in innate immunity and surfactant metabolism, SP-D is produced in the bronchiolar and terminal epithelium of human fetal lung from about 21 weeks of gestation. What’s more, SP-A and SP-D act as dual-function surveillance molecules that reverse orientation and function and become initiators of host-defense reactions.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 12.7pg/mL

SFTPD ELISA Kit (Rat) (OKCD07085)
OKCD07085	Aviva Systems Biology	96 Wells	EUR 1001.00
Description: Description of target: Contributes to the lung's defense against inhaled microorganisms, organic antigens and toxins. Interacts with compounds such as bacterial lipopolysaccharides, oligosaccharides and fatty acids and modulates leukocyte action in immune response. May participate in the extracellular reorganization or turnover of pulmonary surfactant. Binds strongly maltose residues and to a lesser extent other alpha-glucosyl moieties.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 2.6 pg/mL

SFTPD ELISA Kit (Human) (OKCD09548)
OKCD09548	Aviva Systems Biology	96 Wells	EUR 648.00
Description: Description of target: SFTPD contributes to the lung's defense against inhaled microorganisms. SFTPD may participate in the extracellular reorganization or turnover of pulmonary surfactant. SFTPD binds strongly maltose residues and to a lesser extent other alpha-glucosyl moieti;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 2.31ng/mL

SFTPD ELISA Kit (Pig) (OKEH03895)
OKEH03895	Aviva Systems Biology	96 Wells	EUR 779.00
Description: Description of target: Contributes to the lung's defense against inhaled microorganisms, organic antigens and toxins. Interacts with compounds such as bacterial lipopolysaccharides, oligosaccharides and fatty acids and modulates leukocyte action in immune response. May participate in the extracellular reorganization or turnover of pulmonary surfactant. Binds strongly maltose residues and to a lesser extent other alpha-glucosyl moieties.;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.256 ng/mL

SFTPD ELISA Kit (Bovine) (OKEH03896)
OKEH03896	Aviva Systems Biology	96 Wells	EUR 779.00
Description: Description of target: Contributes to the lung's defense against inhaled microorganisms, organic antigens and toxins. Interacts with compounds such as bacterial lipopolysaccharides, oligosaccharides and fatty acids and modulates leukocyte action in immune response. May participate in the extracellular reorganization or turnover of pulmonary surfactant. Binds strongly maltose residues and to a lesser extent other alpha-glucosyl moieties.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.18 ng/mL

SFTPD ELISA Kit (Rat) (OKEH04421)
OKEH04421	Aviva Systems Biology	96 Wells	EUR 662.00
Description: Description of target: binds carbohydrates; may play a role in defense response in the lung [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.087 ng/mL

Sftpd sgRNA CRISPR Lentivector set (Rat)
K6884201	ABM	3 x 1.0 ug	EUR 339.00

Sftpd sgRNA CRISPR Lentivector set (Mouse)
K4332701	ABM	3 x 1.0 ug	EUR 339.00

SFTPD sgRNA CRISPR Lentivector set (Human)
K2135401	ABM	3 x 1.0 ug	EUR 339.00

Anti-Surfactant protein D/SFTPD Antibody
PB9617	BosterBio	100ug/vial	EUR 334.00

Human Pulmonary surfactant-associated protein D (SFTPD)
1-CSB-YP021175HU	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	0 1 2 3 4 5
MW: 35.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Pulmonary surfactant-associated protein D(SFTPD) expressed in Yeast

Monoclonal SFTPD Antibody (monoclonal) (M01), Clone: 3E7
AMR09892G	Leading Biology	0.1mg	EUR 484.00
Description: A Monoclonal antibody against Human SFTPD (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3E7. This antibody is applicable in WB

Monoclonal SFTPD Antibody (monoclonal) (M02), Clone: 2A10
AMR09893G	Leading Biology	0.1mg	EUR 484.00
Description: A Monoclonal antibody against Human SFTPD (monoclonal) (M02). The antibodies are raised in mouse and are from clone 2A10. This antibody is applicable in WB and IHC

Sftpd sgRNA CRISPR Lentivector (Rat) (Target 1)
K6884202	ABM	1.0 ug DNA	EUR 154.00

Sftpd sgRNA CRISPR Lentivector (Rat) (Target 2)
K6884203	ABM	1.0 ug DNA	EUR 154.00

Sftpd sgRNA CRISPR Lentivector (Rat) (Target 3)
K6884204	ABM	1.0 ug DNA	EUR 154.00

Sftpd sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4332702	ABM	1.0 ug DNA	EUR 154.00

Sftpd sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4332703	ABM	1.0 ug DNA	EUR 154.00

Sftpd sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4332704	ABM	1.0 ug DNA	EUR 154.00

SFTPD sgRNA CRISPR Lentivector (Human) (Target 1)
K2135402	ABM	1.0 ug DNA	EUR 154.00

SFTPD sgRNA CRISPR Lentivector (Human) (Target 2)
K2135403	ABM	1.0 ug DNA	EUR 154.00

SFTPD sgRNA CRISPR Lentivector (Human) (Target 3)
K2135404	ABM	1.0 ug DNA	EUR 154.00

SFTPD Surfactant Protein D Human Recombinant Protein
PROTP35247	BosterBio	Regular: 20ug	EUR 317.00
Description: SFTPD Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 175 amino acids (224-375 a.a) and having a molecular mass of 18.9kDa.;SFTPD is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

SFTPD Protein Vector (Rat) (pPB-C-His)
PV304562	ABM	500 ng	EUR 603.00

SFTPD Protein Vector (Rat) (pPB-N-His)
PV304563	ABM	500 ng	EUR 603.00

SFTPD Protein Vector (Rat) (pPM-C-HA)
PV304564	ABM	500 ng	EUR 603.00

SFTPD Protein Vector (Rat) (pPM-C-His)
PV304565	ABM	500 ng	EUR 603.00

SFTPD Protein Vector (Human) (pPB-C-His)
PV037805	ABM	500 ng	EUR 329.00

SFTPD Protein Vector (Human) (pPB-N-His)
PV037806	ABM	500 ng	EUR 329.00

SFTPD Protein Vector (Human) (pPM-C-HA)
PV037807	ABM	500 ng	EUR 329.00

SFTPD Protein Vector (Human) (pPM-C-His)
PV037808	ABM	500 ng	EUR 329.00

SFTPD Protein Vector (Mouse) (pPB-C-His)
PV228550	ABM	500 ng	EUR 603.00

SFTPD Protein Vector (Mouse) (pPB-N-His)
PV228551	ABM	500 ng	EUR 603.00

SFTPD Protein Vector (Mouse) (pPM-C-HA)
PV228552	ABM	500 ng	EUR 603.00

SFTPD Protein Vector (Mouse) (pPM-C-His)
PV228553	ABM	500 ng	EUR 603.00

Recombinant Human SFTPD/SP-D/SFTP4 Protein
RP00117	Abclonal	20 μg	EUR 183.00

Sftpd 3'UTR Luciferase Stable Cell Line
TU118705	ABM	1.0 ml	Ask for price

Sftpd 3'UTR GFP Stable Cell Line
TU168705	ABM	1.0 ml	Ask for price

Sftpd 3'UTR Luciferase Stable Cell Line
TU220248	ABM	1.0 ml	Ask for price