SFTPD Antibody
35929-100ul 100ul
EUR 252.00
SFTPD Antibody
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SFTPD. Recognizes SFTPD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100
SFTPD Antibody
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SFTPD. Recognizes SFTPD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100
SFTPD antibody
70R-5911 50 ug
EUR 467.00
Description: Rabbit polyclonal SFTPD antibody raised against the middle region of SFTPD
SFTPD Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SFTPD. Recognizes SFTPD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SFTPD Blocking Peptide
33R-7253 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SFTPD antibody, catalog no. 70R-5911
SFTPD, human recombinant
EUR 387.00
SFTPD Conjugated Antibody
C35929 100ul
EUR 397.00
SFTPD cloning plasmid
CSB-CL021175HU-10ug 10ug
EUR 426.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1128
  • Sequence: atgctgctcttcctcctctctgcactggtcctgctcacacagcccctgggctacctggaagcaggaatgaagacctactcccacagaacaatgcccagtgcttgcaccctggtcatgtgtagctcagtggagagtggcctgcctggtcgcgatggacgggatgggagagagggcc
  • Show more
Description: A cloning plasmid for the SFTPD gene.
SFTPD Rabbit pAb
A1651-100ul 100 ul
EUR 308.00
SFTPD Rabbit pAb
A1651-200ul 200 ul
EUR 459.00
SFTPD Rabbit pAb
A1651-20ul 20 ul
EUR 183.00
SFTPD Rabbit pAb
A1651-50ul 50 ul
EUR 223.00
SFTPD Polyclonal Antibody
ABP60380-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human SFTPD protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of SFTPD from Human, Mouse, Rat. This SFTPD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SFTPD protein at amino acid sequence of 290-370
SFTPD Polyclonal Antibody
ABP60380-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human SFTPD protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of SFTPD from Human, Mouse, Rat. This SFTPD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SFTPD protein at amino acid sequence of 290-370
SFTPD Polyclonal Antibody
ABP60380-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human SFTPD protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of SFTPD from Human, Mouse, Rat. This SFTPD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SFTPD protein at amino acid sequence of 290-370
SFTPD Polyclonal Antibody
ES10072-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against SFTPD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
SFTPD Polyclonal Antibody
ES10072-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against SFTPD from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Anti-SFTPD antibody
STJ116154 100 µl
EUR 277.00
Description: The protein encoded by this gene is part of the innate immune response, protecting the lungs against inhaled microorganisms and chemicals. The encoded protein may also be involved in surfactant metabolism.
Anti-SFTPD antibody
STJ191230 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to SFTPD
SFTPD protein (His tag)
80R-3864 100 ug
EUR 327.00
Description: Purified recombinant SFTPD protein (His tag)
ELA-E1039h 96 Tests
EUR 824.00
Mouse Sftpd ELISA Kit
ELI-03347m 96 Tests
EUR 865.00
Mouse SFTPD shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Rat SFTPD shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human SFTPD shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
SFTPD Recombinant Protein (Human)
RP028354 100 ug Ask for price
SFTPD Recombinant Protein (Rat)
RP228419 100 ug Ask for price
SFTPD Recombinant Protein (Mouse)
RP171410 100 ug Ask for price
Polyclonal SFTPD Antibody (C-term)
AMR09891G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SFTPD (C-term). This antibody is tested and proven to work in the following applications:
Surfactant Protein D (SFTPD) Antibody
abx027729-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
Surfactant Protein D (SFTPD) Antibody
abx027729-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
Surfactant Protein D (SFTPD) Antibody
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Surfactant Protein D (SFTPD) Antibody
abx238401-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
Surfactant Protein D (SFTPD) Antibody
abx414524-025mg 0.25 mg
EUR 592.00
  • Shipped within 1 week.
Surfactant Protein D (SFTPD) Antibody
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Surfactant Protein D (SFTPD) Antibody
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Sftpd ORF Vector (Rat) (pORF)
ORF076141 1.0 ug DNA
EUR 506.00
SFTPD ORF Vector (Human) (pORF)
ORF009452 1.0 ug DNA
EUR 95.00
Sftpd ORF Vector (Mouse) (pORF)
ORF057138 1.0 ug DNA
EUR 506.00
SFTPD ELISA Kit (Mouse) (OKAN05034)
OKAN05034 96 Wells
EUR 792.00
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12.7 pg/mL
SFTPD ELISA Kit (Rat) (OKAN06602)
OKAN06602 96 Wells
EUR 792.00
Description: Description of target: binds carbohydrates; may play a role in defense response in the lung [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.1 pg/mL
SFTPD ELISA Kit (Human) (OKCD07083)
OKCD07083 96 Wells
EUR 609.00
Description: Description of target: SFTPD contributes to the lung's defense against inhaled microorganisms. SFTPD may participate in the extracellular reorganization or turnover of pulmonary surfactant. SFTPD binds strongly maltose residues and to a lesser extent other alpha-glucosyl moieti;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.233ng/mL
SFTPD ELISA Kit (Mouse) (OKCD07084)
OKCD07084 96 Wells
EUR 701.00
Description: Description of target: Surfactant, pulmonary-associated protein D, also known as SFTPD or SP-D, is a protein which in humans is encoded by the SFTPD gene. By fluorescence in situ hybridization, the SP-D gene was localized in 10q22.2-q23.1. On the basis of homology with other collectins, potential functions for SP-D include roles in innate immunity and surfactant metabolism, SP-D is produced in the bronchiolar and terminal epithelium of human fetal lung from about 21 weeks of gestation. What’s more, SP-A and SP-D act as dual-function surveillance molecules that reverse orientation and function and become initiators of host-defense reactions.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 12.7pg/mL
SFTPD ELISA Kit (Rat) (OKCD07085)
OKCD07085 96 Wells
EUR 1001.00
Description: Description of target: Contributes to the lung's defense against inhaled microorganisms, organic antigens and toxins. Interacts with compounds such as bacterial lipopolysaccharides, oligosaccharides and fatty acids and modulates leukocyte action in immune response. May participate in the extracellular reorganization or turnover of pulmonary surfactant. Binds strongly maltose residues and to a lesser extent other alpha-glucosyl moieties.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 2.6 pg/mL
SFTPD ELISA Kit (Human) (OKCD09548)
OKCD09548 96 Wells
EUR 648.00
Description: Description of target: SFTPD contributes to the lung's defense against inhaled microorganisms. SFTPD may participate in the extracellular reorganization or turnover of pulmonary surfactant. SFTPD binds strongly maltose residues and to a lesser extent other alpha-glucosyl moieti;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 2.31ng/mL
SFTPD ELISA Kit (Pig) (OKEH03895)
OKEH03895 96 Wells
EUR 779.00
Description: Description of target: Contributes to the lung's defense against inhaled microorganisms, organic antigens and toxins. Interacts with compounds such as bacterial lipopolysaccharides, oligosaccharides and fatty acids and modulates leukocyte action in immune response. May participate in the extracellular reorganization or turnover of pulmonary surfactant. Binds strongly maltose residues and to a lesser extent other alpha-glucosyl moieties.;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.256 ng/mL
SFTPD ELISA Kit (Bovine) (OKEH03896)
OKEH03896 96 Wells
EUR 779.00
Description: Description of target: Contributes to the lung's defense against inhaled microorganisms, organic antigens and toxins. Interacts with compounds such as bacterial lipopolysaccharides, oligosaccharides and fatty acids and modulates leukocyte action in immune response. May participate in the extracellular reorganization or turnover of pulmonary surfactant. Binds strongly maltose residues and to a lesser extent other alpha-glucosyl moieties.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.18 ng/mL
SFTPD ELISA Kit (Rat) (OKEH04421)
OKEH04421 96 Wells
EUR 662.00
Description: Description of target: binds carbohydrates; may play a role in defense response in the lung [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.087 ng/mL
Sftpd sgRNA CRISPR Lentivector set (Rat)
K6884201 3 x 1.0 ug
EUR 339.00
Sftpd sgRNA CRISPR Lentivector set (Mouse)
K4332701 3 x 1.0 ug
EUR 339.00
SFTPD sgRNA CRISPR Lentivector set (Human)
K2135401 3 x 1.0 ug
EUR 339.00
Anti-Surfactant protein D/SFTPD Antibody
PB9617 100ug/vial
EUR 334.00
Human Pulmonary surfactant-associated protein D (SFTPD)
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 35.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Pulmonary surfactant-associated protein D(SFTPD) expressed in Yeast
Monoclonal SFTPD Antibody (monoclonal) (M01), Clone: 3E7
AMR09892G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human SFTPD (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3E7. This antibody is applicable in WB
Monoclonal SFTPD Antibody (monoclonal) (M02), Clone: 2A10
AMR09893G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human SFTPD (monoclonal) (M02). The antibodies are raised in mouse and are from clone 2A10. This antibody is applicable in WB and IHC
Sftpd sgRNA CRISPR Lentivector (Rat) (Target 1)
K6884202 1.0 ug DNA
EUR 154.00
Sftpd sgRNA CRISPR Lentivector (Rat) (Target 2)
K6884203 1.0 ug DNA
EUR 154.00
Sftpd sgRNA CRISPR Lentivector (Rat) (Target 3)
K6884204 1.0 ug DNA
EUR 154.00
Sftpd sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4332702 1.0 ug DNA
EUR 154.00
Sftpd sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4332703 1.0 ug DNA
EUR 154.00
Sftpd sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4332704 1.0 ug DNA
EUR 154.00
SFTPD sgRNA CRISPR Lentivector (Human) (Target 1)
K2135402 1.0 ug DNA
EUR 154.00
SFTPD sgRNA CRISPR Lentivector (Human) (Target 2)
K2135403 1.0 ug DNA
EUR 154.00
SFTPD sgRNA CRISPR Lentivector (Human) (Target 3)
K2135404 1.0 ug DNA
EUR 154.00
SFTPD Surfactant Protein D Human Recombinant Protein
PROTP35247 Regular: 20ug
EUR 317.00
Description: SFTPD Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 175 amino acids (224-375 a.a) and having a molecular mass of 18.9kDa.;SFTPD is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
SFTPD Protein Vector (Rat) (pPB-C-His)
PV304562 500 ng
EUR 603.00
SFTPD Protein Vector (Rat) (pPB-N-His)
PV304563 500 ng
EUR 603.00
SFTPD Protein Vector (Rat) (pPM-C-HA)
PV304564 500 ng
EUR 603.00
SFTPD Protein Vector (Rat) (pPM-C-His)
PV304565 500 ng
EUR 603.00
SFTPD Protein Vector (Human) (pPB-C-His)
PV037805 500 ng
EUR 329.00
SFTPD Protein Vector (Human) (pPB-N-His)
PV037806 500 ng
EUR 329.00
SFTPD Protein Vector (Human) (pPM-C-HA)
PV037807 500 ng
EUR 329.00
SFTPD Protein Vector (Human) (pPM-C-His)
PV037808 500 ng
EUR 329.00
SFTPD Protein Vector (Mouse) (pPB-C-His)
PV228550 500 ng
EUR 603.00
SFTPD Protein Vector (Mouse) (pPB-N-His)
PV228551 500 ng
EUR 603.00
SFTPD Protein Vector (Mouse) (pPM-C-HA)
PV228552 500 ng
EUR 603.00
SFTPD Protein Vector (Mouse) (pPM-C-His)
PV228553 500 ng
EUR 603.00
Recombinant Human SFTPD/SP-D/SFTP4 Protein
RP00117 20 μg
EUR 183.00
Sftpd 3'UTR Luciferase Stable Cell Line
TU118705 1.0 ml Ask for price
Sftpd 3'UTR GFP Stable Cell Line
TU168705 1.0 ml Ask for price
Sftpd 3'UTR Luciferase Stable Cell Line
TU220248 1.0 ml Ask for price