SPCS2 antibody
70R-20488 50 ul
EUR 435
Description: Rabbit polyclonal SPCS2 antibody
SPCS2 siRNA
20-abx934899
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SPCS2 siRNA
20-abx934900
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SPCS2 Antibody
1-CSB-PA617993LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPCS2. Recognizes SPCS2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
SPCS2 Antibody
1-CSB-PA022515GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SPCS2. Recognizes SPCS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
SPCS2 Conjugated Antibody
C42942 100ul
EUR 397
SPCS2 cloning plasmid
CSB-CL617993HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 681
  • Sequence: atggcggcggcagctgtacagggcgggagaagcggtggtagcggaggctgtagtggggctggtggtgcttccaactgcgggacaggaagtggccgtagcggcttgttggataagtggaagatagatgataagcctgtaaaaattgacaagtgggatggatcagctgtgaaaaactc
  • Show more
Description: A cloning plasmid for the SPCS2 gene.
SPCS2 cloning plasmid
CSB-CL617993HU2-10ug 10ug
EUR 213
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 372
  • Sequence: ATGCACCCCTTTCCAGAGTCCAAACCCGTTTTGGCTTTGTGTGTCATATCCTATTTTGTGATGATGGGGATTCTGACCATTTATACCTCATATAAGGAGAAGAGCATCTTTCTCGTGGCCCACAGGAAAGATCCTACAGGAATGGATCCTGATGATATTTGGCAGCTGTCCTCCAG
  • Show more
Description: A cloning plasmid for the SPCS2 gene.
anti- SPCS2 antibody
FNab08168 100µg
EUR 548.75
  • Immunogen: signal peptidase complex subunit 2 homolog(S. cerevisiae)
  • Uniprot ID: Q15005
  • Gene ID: 9789
  • Research Area: Metabolism
Description: Antibody raised against SPCS2
SPCS2 Polyclonal Antibody
A64714 100 µg
EUR 570.55
Description: kits suitable for this type of research
Anti-SPCS2 antibody
PAab08168 100 ug
EUR 386
Mouse SPCS2 shRNA Plasmid
20-abx975707
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Canine SPCS2 ELISA KIT
ELI-18259d 96 Tests
EUR 928
SPCS2 ELISA KIT|Human
EF003181 96 Tests
EUR 689
Human SPCS2 shRNA Plasmid
20-abx956551
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SPCS2 Antibody, HRP conjugated
1-CSB-PA617993LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPCS2. Recognizes SPCS2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SPCS2 Antibody, FITC conjugated
1-CSB-PA617993LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPCS2. Recognizes SPCS2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SPCS2 Antibody, Biotin conjugated
1-CSB-PA617993LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPCS2. Recognizes SPCS2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SPCS2 Recombinant Protein (Human)
RP029848 100 ug Ask for price
SPCS2 Recombinant Protein (Human)
RP043705 100 ug Ask for price
SPCS2 Recombinant Protein (Rat)
RP230714 100 ug Ask for price
SPCS2 Recombinant Protein (Mouse)
RP174878 100 ug Ask for price
SPCS2 Polyclonal Antibody, HRP Conjugated
A64715 100 µg
EUR 570.55
Description: fast delivery possible
SPCS2 Polyclonal Antibody, FITC Conjugated
A64716 100 µg
EUR 570.55
Description: reagents widely cited
SPCS2 Polyclonal Antibody, Biotin Conjugated
A64717 100 µg
EUR 570.55
Description: Ask the seller for details
Spcs2 ORF Vector (Mouse) (pORF)
ORF058294 1.0 ug DNA
EUR 506
SPCS2 ORF Vector (Human) (pORF)
ORF009950 1.0 ug DNA
EUR 95
Spcs2 ORF Vector (Rat) (pORF)
ORF076906 1.0 ug DNA
EUR 506
SPCS2 ORF Vector (Human) (pORF)
ORF014569 1.0 ug DNA
EUR 354
SPCS2 sgRNA CRISPR Lentivector set (Human)
K2269601 3 x 1.0 ug
EUR 339
Spcs2 sgRNA CRISPR Lentivector set (Mouse)
K4803001 3 x 1.0 ug
EUR 339
Spcs2 sgRNA CRISPR Lentivector set (Rat)
K6187301 3 x 1.0 ug
EUR 339
Signal Peptidase Complex Subunit 2 (Spcs2) Antibody
20-abx115543
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Signal Peptidase Complex Subunit 2 (SPCS2) Antibody
abx238168-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Signal Peptidase Complex Subunit 2 (SPCS2) Antibody
20-abx301985
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SPCS2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2269602 1.0 ug DNA
EUR 154
SPCS2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2269603 1.0 ug DNA
EUR 154
SPCS2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2269604 1.0 ug DNA
EUR 154
Spcs2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4803002 1.0 ug DNA
EUR 154
Spcs2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4803003 1.0 ug DNA
EUR 154
Spcs2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4803004 1.0 ug DNA
EUR 154
Spcs2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6187302 1.0 ug DNA
EUR 154
Spcs2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6187303 1.0 ug DNA
EUR 154
Spcs2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6187304 1.0 ug DNA
EUR 154
SPCS2 Protein Vector (Human) (pPB-C-His)
PV058273 500 ng
EUR 481
SPCS2 Protein Vector (Human) (pPB-N-His)
PV058274 500 ng
EUR 481
SPCS2 Protein Vector (Human) (pPM-C-HA)
PV058275 500 ng
EUR 481
SPCS2 Protein Vector (Human) (pPM-C-His)
PV058276 500 ng
EUR 481
SPCS2 Protein Vector (Human) (pPB-C-His)
PV039797 500 ng
EUR 329
SPCS2 Protein Vector (Human) (pPB-N-His)
PV039798 500 ng
EUR 329
SPCS2 Protein Vector (Human) (pPM-C-HA)
PV039799 500 ng
EUR 329
SPCS2 Protein Vector (Human) (pPM-C-His)
PV039800 500 ng
EUR 329
SPCS2 Protein Vector (Rat) (pPB-C-His)
PV307622 500 ng
EUR 603
SPCS2 Protein Vector (Rat) (pPB-N-His)
PV307623 500 ng
EUR 603
SPCS2 Protein Vector (Rat) (pPM-C-HA)
PV307624 500 ng
EUR 603
SPCS2 Protein Vector (Rat) (pPM-C-His)
PV307625 500 ng
EUR 603
SPCS2 Protein Vector (Mouse) (pPB-C-His)
PV233174 500 ng
EUR 603
SPCS2 Protein Vector (Mouse) (pPB-N-His)
PV233175 500 ng
EUR 603
SPCS2 Protein Vector (Mouse) (pPM-C-HA)
PV233176 500 ng
EUR 603
SPCS2 Protein Vector (Mouse) (pPM-C-His)
PV233177 500 ng
EUR 603
Spcs2 3'UTR GFP Stable Cell Line
TU169554 1.0 ml Ask for price
Spcs2 3'UTR Luciferase Stable Cell Line
TU119554 1.0 ml Ask for price
SPCS2 3'UTR GFP Stable Cell Line
TU074430 1.0 ml
EUR 1521
SPCS2 3'UTR Luciferase Stable Cell Line
TU024430 1.0 ml
EUR 1521
Spcs2 3'UTR Luciferase Stable Cell Line
TU221054 1.0 ml Ask for price
Spcs2 3'UTR GFP Stable Cell Line
TU271054 1.0 ml Ask for price
Signal Peptidase Complex Subunit 2 (SPCS2) Antibody (HRP)
20-abx306881
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Signal Peptidase Complex Subunit 2 (SPCS2) Antibody (FITC)
20-abx306882
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Signal Peptidase Complex Subunit 2 (SPCS2) Antibody (Biotin)
20-abx306883
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SPCS2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV705963 1.0 ug DNA
EUR 450
SPCS2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV705967 1.0 ug DNA
EUR 450
SPCS2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV705968 1.0 ug DNA
EUR 450
Mouse Signal peptidase complex subunit 2, Spcs2 ELISA KIT
ELI-52854m 96 Tests
EUR 865
Human Signal peptidase complex subunit 2, SPCS2 ELISA KIT
ELI-39499h 96 Tests
EUR 824
Human Signal Peptidase Complex Subunit 2 Homolog (SPCS2) ELISA Kit
20-abx585331
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
SPCS2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2269605 3 x 1.0 ug
EUR 376
Spcs2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4803005 3 x 1.0 ug
EUR 376
Spcs2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6187305 3 x 1.0 ug
EUR 376
SPCS2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2269606 1.0 ug DNA
EUR 167
SPCS2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2269607 1.0 ug DNA
EUR 167
SPCS2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2269608 1.0 ug DNA
EUR 167
Spcs2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4803006 1.0 ug DNA
EUR 167
Spcs2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4803007 1.0 ug DNA
EUR 167
Spcs2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4803008 1.0 ug DNA
EUR 167
Spcs2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6187306 1.0 ug DNA
EUR 167