In den Nachrichten


ST6GALNAC3 Antibody
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC3. Recognizes ST6GALNAC3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
ST6GALNAC3 antibody
70R-7175 50 ug
EUR 467.00
Description: Rabbit polyclonal ST6GALNAC3 antibody raised against the C terminal of ST6GALNAC3
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
ST6GALNAC3 Blocking Peptide
33R-3882 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ST6GALNAC3 antibody, catalog no. 70R-7175
ST6GALNAC3 Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
ST6GALNAC3 Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
ST6GALNAC3 Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
ST6GALNAC3 cloning plasmid
CSB-CL836724HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 918
  • Sequence: atggcctgcatcctgaagagaaagtctgtgattgctgtgagcttcatagcagcgttccttttcctgctggttgtgcgtcttgtaaatgaagtgaatttcccattgctactaaactgctttggacaacctggtacaaagtggataccattctcctacacatacaggcggccccttcg
  • Show more
Description: A cloning plasmid for the ST6GALNAC3 gene.
ST6GALNAC3 Polyclonal Antibody
A66514 100 µg
EUR 570.55
Description: kits suitable for this type of research
ST6GALNAC3 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC3. Recognizes ST6GALNAC3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ST6GALNAC3 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC3. Recognizes ST6GALNAC3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ST6GALNAC3 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC3. Recognizes ST6GALNAC3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
ELI-13612h 96 Tests
EUR 824.00
Mouse St6galnac3 ELISA KIT
ELI-19862m 96 Tests
EUR 865.00
Human ST6GALNAC3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse ST6GALNAC3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Rat ST6GALNAC3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
ST6GALNAC3 Recombinant Protein (Rat)
RP231266 100 ug Ask for price
ST6GALNAC3 Recombinant Protein (Human)
RP030247 100 ug Ask for price
ST6GALNAC3 Recombinant Protein (Mouse)
RP175796 100 ug Ask for price
ST6GALNAC3 Polyclonal Antibody, HRP Conjugated
A66515 100 µg
EUR 570.55
Description: fast delivery possible
ST6GALNAC3 Polyclonal Antibody, FITC Conjugated
A66516 100 µg
EUR 570.55
Description: reagents widely cited
ST6GALNAC3 Polyclonal Antibody, Biotin Conjugated
A66517 100 µg
EUR 570.55
Description: Ask the seller for details
St6galnac3 ORF Vector (Rat) (pORF)
ORF077090 1.0 ug DNA
EUR 506.00
ST6GALNAC3 ORF Vector (Human) (pORF)
ORF010083 1.0 ug DNA
EUR 95.00
St6galnac3 ORF Vector (Mouse) (pORF)
ORF058600 1.0 ug DNA
EUR 506.00
St6galnac3 sgRNA CRISPR Lentivector set (Rat)
K6862101 3 x 1.0 ug
EUR 339.00
St6galnac3 sgRNA CRISPR Lentivector set (Mouse)
K3420601 3 x 1.0 ug
EUR 339.00
ST6GALNAC3 sgRNA CRISPR Lentivector set (Human)
K2295301 3 x 1.0 ug
EUR 339.00
St6galnac3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6862102 1.0 ug DNA
EUR 154.00
St6galnac3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6862103 1.0 ug DNA
EUR 154.00
St6galnac3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6862104 1.0 ug DNA
EUR 154.00
St6galnac3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3420602 1.0 ug DNA
EUR 154.00
St6galnac3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3420603 1.0 ug DNA
EUR 154.00
St6galnac3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3420604 1.0 ug DNA
EUR 154.00
ST6GALNAC3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2295302 1.0 ug DNA
EUR 154.00
ST6GALNAC3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2295303 1.0 ug DNA
EUR 154.00
ST6GALNAC3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2295304 1.0 ug DNA
EUR 154.00
ST6GALNAC3 Protein Vector (Rat) (pPB-C-His)
PV308358 500 ng
EUR 603.00
ST6GALNAC3 Protein Vector (Rat) (pPB-N-His)
PV308359 500 ng
EUR 603.00
ST6GALNAC3 Protein Vector (Rat) (pPM-C-HA)
PV308360 500 ng
EUR 603.00
ST6GALNAC3 Protein Vector (Rat) (pPM-C-His)
PV308361 500 ng
EUR 603.00
ST6GALNAC3 Protein Vector (Human) (pPB-C-His)
PV040329 500 ng
EUR 329.00
ST6GALNAC3 Protein Vector (Human) (pPB-N-His)
PV040330 500 ng
EUR 329.00
ST6GALNAC3 Protein Vector (Human) (pPM-C-HA)
PV040331 500 ng
EUR 329.00
ST6GALNAC3 Protein Vector (Human) (pPM-C-His)
PV040332 500 ng
EUR 329.00
ST6GALNAC3 Protein Vector (Mouse) (pPB-C-His)
PV234398 500 ng
EUR 603.00
ST6GALNAC3 Protein Vector (Mouse) (pPB-N-His)
PV234399 500 ng
EUR 603.00
ST6GALNAC3 Protein Vector (Mouse) (pPM-C-HA)
PV234400 500 ng
EUR 603.00
ST6GALNAC3 Protein Vector (Mouse) (pPM-C-His)
PV234401 500 ng
EUR 603.00
St6galnac3 3'UTR Luciferase Stable Cell Line
TU119779 1.0 ml Ask for price
St6galnac3 3'UTR GFP Stable Cell Line
TU169779 1.0 ml Ask for price
St6galnac3 3'UTR Luciferase Stable Cell Line
TU221248 1.0 ml Ask for price
ST6GALNAC3 3'UTR GFP Stable Cell Line
TU074713 1.0 ml
EUR 4617.00
St6galnac3 3'UTR GFP Stable Cell Line
TU271248 1.0 ml Ask for price
ST6GALNAC3 3'UTR Luciferase Stable Cell Line
TU024713 1.0 ml
EUR 4617.00
ST6GALNAC3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV625297 1.0 ug DNA
EUR 514.00
ST6GALNAC3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV625301 1.0 ug DNA
EUR 514.00
ST6GALNAC3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV625302 1.0 ug DNA
EUR 514.00
Alpha-N-Acetylgalactosaminide Alpha-2,6-Sialyltransferase 3 (ST6GALNAC3) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
St6galnac3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6862105 3 x 1.0 ug
EUR 376.00
St6galnac3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3420605 3 x 1.0 ug
EUR 376.00
ST6GALNAC3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2295305 3 x 1.0 ug
EUR 376.00
Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E01A1993-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E01A1993-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E01A1993-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E03A1993-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E03A1993-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E03A1993-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E06A1993-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E06A1993-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E06A1993-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E04A1993-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E04A1993-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E04A1993-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E02A1993-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E02A1993-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E02A1993-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E07A1993-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E07A1993-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E07A1993-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E08A1993-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E08A1993-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.