STOML2 siRNA
20-abx905340	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

STOML2 antibody
70R-20609	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal STOML2 antibody

STOML2 Antibody
39917-100ul	SAB	100ul	EUR 390.00

STOML2 antibody
70R-10371	Fitzgerald	50 ug	EUR 467.00
Description: Affinity purified rabbit polyclonal STOML2 antibody

STOML2 siRNA
20-abx935507	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

STOML2 siRNA
20-abx935508	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

STOML2 Antibody
1-CSB-PA892131ESR1HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STOML2. Recognizes STOML2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STOML2 Antibody
DF12010	Affbiotech	200ul	EUR 304.00
Description: STOML2 antibody detects endogenous levels of STOML2.

STOML2 Antibody
1-CSB-PA022864GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STOML2. Recognizes STOML2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

pOTB7-STOML2
PVT19033	Lifescience Market	2 ug	EUR 231.00

anti-STOML2
YF-PA18713	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to STOML2

anti-STOML2
YF-PA18714	Abfrontier	100 ul	EUR 403.00
Description: Rabbit polyclonal to STOML2

anti-STOML2
YF-PA18715	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to STOML2

anti- STOML2 antibody
FNab08346	FN Test	100µg	EUR 548.75
Immunogen: stomatin(EPB72)-like 2 Uniprot ID: Q9UJZ1 Gene ID: 30968 Research Area: cancer
Description: Antibody raised against STOML2

anti- STOML2 antibody
FNab08347	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:2000-1:10000 IP: 1:500-1:1000 IHC: 1:50-1:500 Immunogen: stomatin(EPB72)-like 2 Uniprot ID: Q9UJZ1 Gene ID: 30968 Research Area: cancer
Description: Antibody raised against STOML2

STOML2 Rabbit pAb
A10398-100ul	Abclonal	100 ul	EUR 308.00

STOML2 Rabbit pAb
A10398-200ul	Abclonal	200 ul	EUR 459.00

STOML2 Rabbit pAb
A10398-20ul	Abclonal	20 ul	EUR 183.00

STOML2 Rabbit pAb
A10398-50ul	Abclonal	50 ul	EUR 223.00

STOML2 Rabbit pAb
A4688-100ul	Abclonal	100 ul	EUR 308.00

STOML2 Rabbit pAb
A4688-200ul	Abclonal	200 ul	EUR 459.00

STOML2 Rabbit pAb
A4688-20ul	Abclonal	20 ul	Ask for price

STOML2 Rabbit pAb
A4688-50ul	Abclonal	50 ul	Ask for price

STOML2 Blocking Peptide
33R-9858	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STOML2 antibody, catalog no. 70R-10371

STOML2 Polyclonal Antibody
27419-100ul	SAB	100ul	EUR 252.00

STOML2 Polyclonal Antibody
27419-50ul	SAB	50ul	EUR 187.00

STOML2 Blocking Peptide
DF12010-BP	Affbiotech	1mg	EUR 195.00

STOML2 cloning plasmid
CSB-CL892131HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1071 Sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcc Show more
Description: A cloning plasmid for the STOML2 gene.

STOML2 cloning plasmid
CSB-CL892131HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1071 Sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcc Show more
Description: A cloning plasmid for the STOML2 gene.

Anti-STOML2 antibody
PAab08346	Lifescience Market	100 ug	EUR 386.00

pOTB7-stoml2 Plasmid
PVTB00105	Lifescience Market	2 ug	EUR 356.00

pOTB7-STOML2 Plasmid
PVTB00250S	Lifescience Market	2 ug	EUR 356.00

pENTR223-STOML2 vector
PVT12019	Lifescience Market	2 ug	EUR 308.00

Anti-STOML2 antibody
STJ25737	St John's Laboratory	100 µl	EUR 277.00

Anti-STOML2 antibody
STJ112434	St John's Laboratory	100 µl	EUR 277.00

Polyclonal STOML2 Antibody (Center)
APR04539G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STOML2 (Center). This antibody is tested and proven to work in the following applications:

STOML2 Polyclonal Conjugated Antibody
C27419	SAB	100ul	EUR 397.00

Mouse STOML2 shRNA Plasmid
20-abx975687	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat STOML2 shRNA Plasmid
20-abx988911	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

STOML2 ELISA KIT|Human
EF003324	Lifescience Market	96 Tests	EUR 689.00

Human STOML2 shRNA Plasmid
20-abx959362	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

STOML2 Recombinant Protein (Human)
RP030469	ABM	100 ug	Ask for price

STOML2 Recombinant Protein (Human)
RP030472	ABM	100 ug	Ask for price

STOML2 Recombinant Protein (Rat)
RP231512	ABM	100 ug	Ask for price

STOML2 Recombinant Protein (Mouse)
RP176132	ABM	100 ug	Ask for price

pCMV-SPORT6-Stoml2-m
PVT18858	Lifescience Market	2 ug	EUR 231.00

Stomatin Like 2 (STOML2) Antibody
20-abx126669	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
abx036120-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
20-abx003539	Abbexa	EUR 411.00 EUR 592.00	0 1
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
abx031486-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
abx031486-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
20-abx321350	Abbexa	EUR 439.00 EUR 328.00	0 1
Shipped within 5-10 working days.

Stomatin Like 2 (STOML2) Antibody
abx238346-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Stomatin Like 2 (STOML2) Antibody
abx238347-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Stoml2 ORF Vector (Mouse) (pORF)
ORF058712	ABM	1.0 ug DNA	EUR 506.00

STOML2 ORF Vector (Human) (pORF)
ORF010157	ABM	1.0 ug DNA	EUR 95.00

STOML2 ORF Vector (Human) (pORF)
ORF010158	ABM	1.0 ug DNA	EUR 95.00

Stoml2 ORF Vector (Rat) (pORF)
ORF077172	ABM	1.0 ug DNA	EUR 506.00

STOML2 sgRNA CRISPR Lentivector set (Human)
K2305701	ABM	3 x 1.0 ug	EUR 339.00

Stoml2 sgRNA CRISPR Lentivector set (Mouse)
K4605401	ABM	3 x 1.0 ug	EUR 339.00

Stoml2 sgRNA CRISPR Lentivector set (Rat)
K7189501	ABM	3 x 1.0 ug	EUR 339.00

Human Stomatin Like 2 (STOML2) ELISA Kit
abx383537-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

STOML2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2305702	ABM	1.0 ug DNA	EUR 154.00

STOML2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2305703	ABM	1.0 ug DNA	EUR 154.00

STOML2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2305704	ABM	1.0 ug DNA	EUR 154.00

Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4605402	ABM	1.0 ug DNA	EUR 154.00

Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4605403	ABM	1.0 ug DNA	EUR 154.00

Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4605404	ABM	1.0 ug DNA	EUR 154.00

Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7189502	ABM	1.0 ug DNA	EUR 154.00

Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7189503	ABM	1.0 ug DNA	EUR 154.00

Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7189504	ABM	1.0 ug DNA	EUR 154.00

STOML2 Protein Vector (Human) (pPB-C-His)
PV040625	ABM	500 ng	EUR 329.00

STOML2 Protein Vector (Human) (pPB-N-His)
PV040626	ABM	500 ng	EUR 329.00

STOML2 Protein Vector (Human) (pPM-C-HA)
PV040627	ABM	500 ng	EUR 329.00

STOML2 Protein Vector (Human) (pPM-C-His)
PV040628	ABM	500 ng	EUR 329.00

STOML2 Protein Vector (Human) (pPB-C-His)
PV040629	ABM	500 ng	EUR 329.00

STOML2 Protein Vector (Human) (pPB-N-His)
PV040630	ABM	500 ng	EUR 329.00

STOML2 Protein Vector (Human) (pPM-C-HA)
PV040631	ABM	500 ng	EUR 329.00

STOML2 Protein Vector (Human) (pPM-C-His)
PV040632	ABM	500 ng	EUR 329.00

STOML2 Protein Vector (Rat) (pPB-C-His)
PV308686	ABM	500 ng	EUR 603.00

STOML2 Protein Vector (Rat) (pPB-N-His)
PV308687	ABM	500 ng	EUR 603.00

STOML2 Protein Vector (Rat) (pPM-C-HA)
PV308688	ABM	500 ng	EUR 603.00

STOML2 Protein Vector (Rat) (pPM-C-His)
PV308689	ABM	500 ng	EUR 603.00

STOML2 Protein Vector (Mouse) (pPB-C-His)
PV234846	ABM	500 ng	EUR 603.00

STOML2 Protein Vector (Mouse) (pPB-N-His)
PV234847	ABM	500 ng	EUR 603.00