
STOML2 antibody
70R-10371 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal STOML2 antibody
STOML2 antibody
70R-20609 50 ul
EUR 435.00
Description: Rabbit polyclonal STOML2 antibody
STOML2 Antibody
39917-100ul 100ul
EUR 390.00
STOML2 Antibody
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STOML2. Recognizes STOML2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
STOML2 Antibody
DF12010 200ul
EUR 304.00
Description: STOML2 antibody detects endogenous levels of STOML2.
STOML2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STOML2. Recognizes STOML2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
PVT19033 2 ug
EUR 231.00
YF-PA18713 50 ug
EUR 363.00
Description: Mouse polyclonal to STOML2
YF-PA18714 100 ul
EUR 403.00
Description: Rabbit polyclonal to STOML2
YF-PA18715 100 ug
EUR 403.00
Description: Rabbit polyclonal to STOML2
STOML2 Polyclonal Antibody
27419-100ul 100ul
EUR 252.00
STOML2 Polyclonal Antibody
27419-50ul 50ul
EUR 187.00
STOML2 Rabbit pAb
A10398-100ul 100 ul
EUR 308.00
STOML2 Rabbit pAb
A10398-200ul 200 ul
EUR 459.00
STOML2 Rabbit pAb
A10398-20ul 20 ul
EUR 183.00
STOML2 Rabbit pAb
A10398-50ul 50 ul
EUR 223.00
STOML2 Blocking Peptide
33R-9858 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STOML2 antibody, catalog no. 70R-10371
STOML2 cloning plasmid
CSB-CL892131HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1071
  • Sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcc
  • Show more
Description: A cloning plasmid for the STOML2 gene.
STOML2 cloning plasmid
CSB-CL892131HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1071
  • Sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcc
  • Show more
Description: A cloning plasmid for the STOML2 gene.
STOML2 Blocking Peptide
DF12010-BP 1mg
EUR 195.00
STOML2 Rabbit pAb
A4688-100ul 100 ul
EUR 308.00
STOML2 Rabbit pAb
A4688-200ul 200 ul
EUR 459.00
STOML2 Rabbit pAb
A4688-20ul 20 ul Ask for price
STOML2 Rabbit pAb
A4688-50ul 50 ul Ask for price
anti- STOML2 antibody
FNab08346 100µg
EUR 548.75
  • Immunogen: stomatin(EPB72)-like 2
  • Uniprot ID: Q9UJZ1
  • Gene ID: 30968
  • Research Area: cancer
Description: Antibody raised against STOML2
anti- STOML2 antibody
FNab08347 100µg
EUR 548.75
  • Recommended dilution: WB: 1:2000-1:10000
  • IP: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: stomatin(EPB72)-like 2
  • Uniprot ID: Q9UJZ1
  • Gene ID: 30968
  • Research Area: cancer
Description: Antibody raised against STOML2
Anti-STOML2 antibody
PAab08346 100 ug
EUR 386.00
pENTR223-STOML2 vector
PVT12019 2 ug
EUR 308.00
pOTB7-stoml2 Plasmid
PVTB00105 2 ug
EUR 356.00
pOTB7-STOML2 Plasmid
PVTB00250S 2 ug
EUR 356.00
Anti-STOML2 antibody
STJ25737 100 µl
EUR 277.00
Anti-STOML2 antibody
STJ112434 100 µl
EUR 277.00
Polyclonal STOML2 Antibody (Center)
APR04539G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STOML2 (Center). This antibody is tested and proven to work in the following applications:
EF003324 96 Tests
EUR 689.00
Rat STOML2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse STOML2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
STOML2 Polyclonal Conjugated Antibody
C27419 100ul
EUR 397.00
Human STOML2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
STOML2 Recombinant Protein (Rat)
RP231512 100 ug Ask for price
PVT18858 2 ug
EUR 231.00
STOML2 Recombinant Protein (Human)
RP030469 100 ug Ask for price
STOML2 Recombinant Protein (Human)
RP030472 100 ug Ask for price
STOML2 Recombinant Protein (Mouse)
RP176132 100 ug Ask for price
Stomatin Like 2 (STOML2) Antibody
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Stomatin Like 2 (STOML2) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
Stomatin Like 2 (STOML2) Antibody
abx036120-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.
Stomatin Like 2 (STOML2) Antibody
abx031486-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
Stomatin Like 2 (STOML2) Antibody
abx031486-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
Stomatin Like 2 (STOML2) Antibody
abx238346-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
Stomatin Like 2 (STOML2) Antibody
abx238347-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
Stomatin Like 2 (STOML2) Antibody
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Stoml2 ORF Vector (Rat) (pORF)
ORF077172 1.0 ug DNA
EUR 506.00
STOML2 ORF Vector (Human) (pORF)
ORF010157 1.0 ug DNA
EUR 95.00
STOML2 ORF Vector (Human) (pORF)
ORF010158 1.0 ug DNA
EUR 95.00
Stoml2 ORF Vector (Mouse) (pORF)
ORF058712 1.0 ug DNA
EUR 506.00
Stoml2 sgRNA CRISPR Lentivector set (Rat)
K7189501 3 x 1.0 ug
EUR 339.00
Stoml2 sgRNA CRISPR Lentivector set (Mouse)
K4605401 3 x 1.0 ug
EUR 339.00
STOML2 sgRNA CRISPR Lentivector set (Human)
K2305701 3 x 1.0 ug
EUR 339.00
Human Stomatin Like 2 (STOML2) ELISA Kit
abx383537-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.
Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7189502 1.0 ug DNA
EUR 154.00
Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7189503 1.0 ug DNA
EUR 154.00
Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7189504 1.0 ug DNA
EUR 154.00
Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4605402 1.0 ug DNA
EUR 154.00
Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4605403 1.0 ug DNA
EUR 154.00
Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4605404 1.0 ug DNA
EUR 154.00
STOML2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2305702 1.0 ug DNA
EUR 154.00
STOML2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2305703 1.0 ug DNA
EUR 154.00
STOML2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2305704 1.0 ug DNA
EUR 154.00
STOML2 Protein Vector (Rat) (pPB-C-His)
PV308686 500 ng
EUR 603.00
STOML2 Protein Vector (Rat) (pPB-N-His)
PV308687 500 ng
EUR 603.00
STOML2 Protein Vector (Rat) (pPM-C-HA)
PV308688 500 ng
EUR 603.00
STOML2 Protein Vector (Rat) (pPM-C-His)
PV308689 500 ng
EUR 603.00
STOML2 Protein Vector (Human) (pPB-C-His)
PV040625 500 ng
EUR 329.00
STOML2 Protein Vector (Human) (pPB-N-His)
PV040626 500 ng
EUR 329.00
STOML2 Protein Vector (Human) (pPM-C-HA)
PV040627 500 ng
EUR 329.00
STOML2 Protein Vector (Human) (pPM-C-His)
PV040628 500 ng
EUR 329.00
STOML2 Protein Vector (Human) (pPB-C-His)
PV040629 500 ng
EUR 329.00
STOML2 Protein Vector (Human) (pPB-N-His)
PV040630 500 ng
EUR 329.00
STOML2 Protein Vector (Human) (pPM-C-HA)
PV040631 500 ng
EUR 329.00
STOML2 Protein Vector (Human) (pPM-C-His)
PV040632 500 ng
EUR 329.00
STOML2 Protein Vector (Mouse) (pPB-C-His)
PV234846 500 ng
EUR 603.00
STOML2 Protein Vector (Mouse) (pPB-N-His)
PV234847 500 ng
EUR 603.00