SUMF2 Antibody
1-CSB-PA022947GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SUMF2. Recognizes SUMF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
SUMF2 siRNA
20-abx935662
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SUMF2 siRNA
20-abx935663
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-SUMF2
YF-PA25951 50 ul
EUR 334
Description: Mouse polyclonal to SUMF2
SUMF2 Polyclonal Antibody
30117-100ul 100ul
EUR 252
SUMF2 Polyclonal Antibody
30117-50ul 50ul
EUR 187
SUMF2 cloning plasmid
CSB-CL839844HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 933
  • Sequence: atggtccaactgcagggtgggagattcctgatgggaacaaattctccagacagcagagatggtgaagggcctgtgcgggaggcgacagtgaaaccctttgccatcgacatatttcctgtcaccaacaaagatttcagggattttgtcagggagaaaaagtatcggacagaagctga
  • Show more
Description: A cloning plasmid for the SUMF2 gene.
SUMF2 cloning plasmid
CSB-CL839844HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 162
  • Sequence: atgcgcgtcctccggggggcatcctggatcgacacagctgatggctctgccaatcaccgggcccgggtcaccaccaggatgggcaacactccagattcagcctcagacaacctcggtttccgctgtgctgcagacgcaggccggccgccaggggagctgtaa
Description: A cloning plasmid for the SUMF2 gene.
SUMF2 cloning plasmid
CSB-CL839844HU3-10ug 10ug
EUR 363
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 906
  • Sequence: ATGGCCCGGCATGGGTTACCGCTGCTGCCCCTGCTGTCGCTCCTGGTCGGCGCGTGGCTCAAGCTAGGAAATGGACAGGCTACTAGCATGGTCCAACTGCAGGGTGGGAGATTCCTGATGGGAACAAATTCTCCAGACAGCAGAGATGGTGAAGGGCCTGTGCGGGAGGCGACAGT
  • Show more
Description: A cloning plasmid for the SUMF2 gene.
SUMF2 Rabbit pAb
A17671-100ul 100 ul
EUR 308
SUMF2 Rabbit pAb
A17671-200ul 200 ul
EUR 459
SUMF2 Rabbit pAb
A17671-20ul 20 ul
EUR 183
SUMF2 Rabbit pAb
A17671-50ul 50 ul
EUR 223
anti- SUMF2 antibody
FNab08388 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: sulfatase modifying factor 2
  • Uniprot ID: Q8NBJ7
  • Gene ID: 25870
  • Research Area: Metabolism
Description: Antibody raised against SUMF2
anti-SUMF2 (4B3)
LF-MA10327 100 ug
EUR 363
Description: Mouse monoclonal to SUMF2
Anti-SUMF2 antibody
PAab08388 100 ug
EUR 386
Anti-SUMF2 antibody
STJ119720 100 µl
EUR 277
Description: The catalytic sites of sulfatases are only active if they contain a unique amino acid, C-alpha-formylglycine (FGly). The FGly residue is posttranslationally generated from a cysteine by enzymes with FGly-generating activity. The gene described in this record is a member of the sulfatase-modifying factor family and encodes a protein with a DUF323 domain that localizes to the lumen of the endoplasmic reticulum. This protein has low levels of FGly-generating activity but can heterodimerize with another family member - a protein with high levels of FGly-generating activity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
SUMF2 ELISA KIT|Human
EF003358 96 Tests
EUR 689
Mouse SUMF2 shRNA Plasmid
20-abx976391
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SUMF2 Polyclonal Conjugated Antibody
C30117 100ul
EUR 397
Human SUMF2 shRNA Plasmid
20-abx958553
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SUMF2 Recombinant Protein (Rat)
RP231722 100 ug Ask for price
SUMF2 Recombinant Protein (Human)
RP043858 100 ug Ask for price
SUMF2 Recombinant Protein (Human)
RP030625 100 ug Ask for price
SUMF2 Recombinant Protein (Human)
RP030628 100 ug Ask for price
SUMF2 Recombinant Protein (Mouse)
RP176444 100 ug Ask for price
Sumf2 ORF Vector (Rat) (pORF)
ORF077242 1.0 ug DNA
EUR 506
SUMF2 ORF Vector (Human) (pORF)
ORF014620 1.0 ug DNA
EUR 354
SUMF2 ORF Vector (Human) (pORF)
ORF010209 1.0 ug DNA
EUR 95
SUMF2 ORF Vector (Human) (pORF)
ORF010210 1.0 ug DNA
EUR 95
Sumf2 ORF Vector (Mouse) (pORF)
ORF058816 1.0 ug DNA
EUR 506
Sulfatase Modifying Factor 2 (SUMF2) Antibody
abx145875-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Sulfatase Modifying Factor 2 (SUMF2) Antibody
abx238388-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Sumf2 sgRNA CRISPR Lentivector set (Rat)
K7223101 3 x 1.0 ug
EUR 339
Sumf2 sgRNA CRISPR Lentivector set (Mouse)
K3820801 3 x 1.0 ug
EUR 339
SUMF2 sgRNA CRISPR Lentivector set (Human)
K2313701 3 x 1.0 ug
EUR 339
Sumf2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7223102 1.0 ug DNA
EUR 154
Sumf2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7223103 1.0 ug DNA
EUR 154
Sumf2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7223104 1.0 ug DNA
EUR 154
Sumf2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3820802 1.0 ug DNA
EUR 154
Sumf2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3820803 1.0 ug DNA
EUR 154
Sumf2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3820804 1.0 ug DNA
EUR 154
SUMF2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2313702 1.0 ug DNA
EUR 154
SUMF2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2313703 1.0 ug DNA
EUR 154
SUMF2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2313704 1.0 ug DNA
EUR 154
SUMF2 Protein Vector (Rat) (pPB-C-His)
PV308966 500 ng
EUR 603
SUMF2 Protein Vector (Rat) (pPB-N-His)
PV308967 500 ng
EUR 603
SUMF2 Protein Vector (Rat) (pPM-C-HA)
PV308968 500 ng
EUR 603
SUMF2 Protein Vector (Rat) (pPM-C-His)
PV308969 500 ng
EUR 603
SUMF2 Protein Vector (Human) (pPB-C-His)
PV058477 500 ng
EUR 481
SUMF2 Protein Vector (Human) (pPB-N-His)
PV058478 500 ng
EUR 481
SUMF2 Protein Vector (Human) (pPM-C-HA)
PV058479 500 ng
EUR 481
SUMF2 Protein Vector (Human) (pPM-C-His)
PV058480 500 ng
EUR 481
SUMF2 Protein Vector (Human) (pPB-C-His)
PV040833 500 ng
EUR 329
SUMF2 Protein Vector (Human) (pPB-N-His)
PV040834 500 ng
EUR 329
SUMF2 Protein Vector (Human) (pPM-C-HA)
PV040835 500 ng
EUR 329
SUMF2 Protein Vector (Human) (pPM-C-His)
PV040836 500 ng
EUR 329
SUMF2 Protein Vector (Human) (pPB-C-His)
PV040837 500 ng
EUR 329
SUMF2 Protein Vector (Human) (pPB-N-His)
PV040838 500 ng
EUR 329
SUMF2 Protein Vector (Human) (pPM-C-HA)
PV040839 500 ng
EUR 329
SUMF2 Protein Vector (Human) (pPM-C-His)
PV040840 500 ng
EUR 329
SUMF2 Protein Vector (Mouse) (pPB-C-His)
PV235262 500 ng
EUR 603
SUMF2 Protein Vector (Mouse) (pPB-N-His)
PV235263 500 ng
EUR 603
SUMF2 Protein Vector (Mouse) (pPM-C-HA)
PV235264 500 ng
EUR 603
SUMF2 Protein Vector (Mouse) (pPM-C-His)
PV235265 500 ng
EUR 603
Sumf2 3'UTR Luciferase Stable Cell Line
TU119944 1.0 ml Ask for price
Sumf2 3'UTR GFP Stable Cell Line
TU169944 1.0 ml Ask for price
Sumf2 3'UTR Luciferase Stable Cell Line
TU221405 1.0 ml Ask for price
SUMF2 3'UTR GFP Stable Cell Line
TU074924 1.0 ml
EUR 2333
Sumf2 3'UTR GFP Stable Cell Line
TU271405 1.0 ml Ask for price
SUMF2 3'UTR Luciferase Stable Cell Line
TU024924 1.0 ml
EUR 2333
Bovine Sulfatase- modifying factor 2, SUMF2 ELISA KIT
ELI-29910b 96 Tests
EUR 928
Mouse Sulfatase- modifying factor 2, Sumf2 ELISA KIT
ELI-53384m 96 Tests
EUR 865
Human Sulfatase Modifying Factor 2 (SUMF2) ELISA Kit
abx383568-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
SUMF2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV715575 1.0 ug DNA
EUR 316