SUMF2

SUMF2 Antibody
1-CSB-PA022947GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SUMF2. Recognizes SUMF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SUMF2 siRNA
20-abx935662	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SUMF2 siRNA
20-abx935663	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-SUMF2
YF-PA25951	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to SUMF2

SUMF2 Polyclonal Antibody
30117-100ul	SAB	100ul	EUR 252

SUMF2 Polyclonal Antibody
30117-50ul	SAB	50ul	EUR 187

SUMF2 cloning plasmid
CSB-CL839844HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 933 Sequence: atggtccaactgcagggtgggagattcctgatgggaacaaattctccagacagcagagatggtgaagggcctgtgcgggaggcgacagtgaaaccctttgccatcgacatatttcctgtcaccaacaaagatttcagggattttgtcagggagaaaaagtatcggacagaagctga Show more
Description: A cloning plasmid for the SUMF2 gene.

SUMF2 cloning plasmid
CSB-CL839844HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 162 Sequence: atgcgcgtcctccggggggcatcctggatcgacacagctgatggctctgccaatcaccgggcccgggtcaccaccaggatgggcaacactccagattcagcctcagacaacctcggtttccgctgtgctgcagacgcaggccggccgccaggggagctgtaa
Description: A cloning plasmid for the SUMF2 gene.

SUMF2 cloning plasmid
CSB-CL839844HU3-10ug	Cusabio	10ug	EUR 363
Formulation: 10 μg plasmid + 200μl Glycerol Length: 906 Sequence: ATGGCCCGGCATGGGTTACCGCTGCTGCCCCTGCTGTCGCTCCTGGTCGGCGCGTGGCTCAAGCTAGGAAATGGACAGGCTACTAGCATGGTCCAACTGCAGGGTGGGAGATTCCTGATGGGAACAAATTCTCCAGACAGCAGAGATGGTGAAGGGCCTGTGCGGGAGGCGACAGT Show more
Description: A cloning plasmid for the SUMF2 gene.

SUMF2 Rabbit pAb
A17671-100ul	Abclonal	100 ul	EUR 308

SUMF2 Rabbit pAb
A17671-200ul	Abclonal	200 ul	EUR 459

SUMF2 Rabbit pAb
A17671-20ul	Abclonal	20 ul	EUR 183

SUMF2 Rabbit pAb
A17671-50ul	Abclonal	50 ul	EUR 223

anti- SUMF2 antibody
FNab08388	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IP: 1:500-1:1000 IHC: 1:50-1:500 Immunogen: sulfatase modifying factor 2 Uniprot ID: Q8NBJ7 Gene ID: 25870 Research Area: Metabolism
Description: Antibody raised against SUMF2

anti-SUMF2 (4B3)
LF-MA10327	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SUMF2

Anti-SUMF2 antibody
PAab08388	Lifescience Market	100 ug	EUR 386

Anti-SUMF2 antibody
STJ119720	St John's Laboratory	100 µl	EUR 277
Description: The catalytic sites of sulfatases are only active if they contain a unique amino acid, C-alpha-formylglycine (FGly). The FGly residue is posttranslationally generated from a cysteine by enzymes with FGly-generating activity. The gene described in this record is a member of the sulfatase-modifying factor family and encodes a protein with a DUF323 domain that localizes to the lumen of the endoplasmic reticulum. This protein has low levels of FGly-generating activity but can heterodimerize with another family member - a protein with high levels of FGly-generating activity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

SUMF2 ELISA KIT|Human
EF003358	Lifescience Market	96 Tests	EUR 689

Mouse SUMF2 shRNA Plasmid
20-abx976391	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SUMF2 Polyclonal Conjugated Antibody
C30117	SAB	100ul	EUR 397

Human SUMF2 shRNA Plasmid
20-abx958553	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SUMF2 Recombinant Protein (Rat)
RP231722	ABM	100 ug	Ask for price

SUMF2 Recombinant Protein (Human)
RP043858	ABM	100 ug	Ask for price

SUMF2 Recombinant Protein (Human)
RP030625	ABM	100 ug	Ask for price

SUMF2 Recombinant Protein (Human)
RP030628	ABM	100 ug	Ask for price

SUMF2 Recombinant Protein (Mouse)
RP176444	ABM	100 ug	Ask for price

Sumf2 ORF Vector (Rat) (pORF)
ORF077242	ABM	1.0 ug DNA	EUR 506

SUMF2 ORF Vector (Human) (pORF)
ORF014620	ABM	1.0 ug DNA	EUR 354

SUMF2 ORF Vector (Human) (pORF)
ORF010209	ABM	1.0 ug DNA	EUR 95

SUMF2 ORF Vector (Human) (pORF)
ORF010210	ABM	1.0 ug DNA	EUR 95

Sumf2 ORF Vector (Mouse) (pORF)
ORF058816	ABM	1.0 ug DNA	EUR 506

Sulfatase Modifying Factor 2 (SUMF2) Antibody
abx145875-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Sulfatase Modifying Factor 2 (SUMF2) Antibody
abx238388-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Sumf2 sgRNA CRISPR Lentivector set (Rat)
K7223101	ABM	3 x 1.0 ug	EUR 339

Sumf2 sgRNA CRISPR Lentivector set (Mouse)
K3820801	ABM	3 x 1.0 ug	EUR 339

SUMF2 sgRNA CRISPR Lentivector set (Human)
K2313701	ABM	3 x 1.0 ug	EUR 339

Sumf2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7223102	ABM	1.0 ug DNA	EUR 154

Sumf2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7223103	ABM	1.0 ug DNA	EUR 154

Sumf2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7223104	ABM	1.0 ug DNA	EUR 154

Sumf2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3820802	ABM	1.0 ug DNA	EUR 154

Sumf2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3820803	ABM	1.0 ug DNA	EUR 154

Sumf2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3820804	ABM	1.0 ug DNA	EUR 154

SUMF2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2313702	ABM	1.0 ug DNA	EUR 154

SUMF2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2313703	ABM	1.0 ug DNA	EUR 154

SUMF2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2313704	ABM	1.0 ug DNA	EUR 154

SUMF2 Protein Vector (Rat) (pPB-C-His)
PV308966	ABM	500 ng	EUR 603

SUMF2 Protein Vector (Rat) (pPB-N-His)
PV308967	ABM	500 ng	EUR 603

SUMF2 Protein Vector (Rat) (pPM-C-HA)
PV308968	ABM	500 ng	EUR 603

SUMF2 Protein Vector (Rat) (pPM-C-His)
PV308969	ABM	500 ng	EUR 603

SUMF2 Protein Vector (Human) (pPB-C-His)
PV058477	ABM	500 ng	EUR 481

SUMF2 Protein Vector (Human) (pPB-N-His)
PV058478	ABM	500 ng	EUR 481

SUMF2 Protein Vector (Human) (pPM-C-HA)
PV058479	ABM	500 ng	EUR 481

SUMF2 Protein Vector (Human) (pPM-C-His)
PV058480	ABM	500 ng	EUR 481

SUMF2 Protein Vector (Human) (pPB-C-His)
PV040833	ABM	500 ng	EUR 329

SUMF2 Protein Vector (Human) (pPB-N-His)
PV040834	ABM	500 ng	EUR 329

SUMF2 Protein Vector (Human) (pPM-C-HA)
PV040835	ABM	500 ng	EUR 329

SUMF2 Protein Vector (Human) (pPM-C-His)
PV040836	ABM	500 ng	EUR 329

SUMF2 Protein Vector (Human) (pPB-C-His)
PV040837	ABM	500 ng	EUR 329

SUMF2 Protein Vector (Human) (pPB-N-His)
PV040838	ABM	500 ng	EUR 329

SUMF2 Protein Vector (Human) (pPM-C-HA)
PV040839	ABM	500 ng	EUR 329

SUMF2 Protein Vector (Human) (pPM-C-His)
PV040840	ABM	500 ng	EUR 329

SUMF2 Protein Vector (Mouse) (pPB-C-His)
PV235262	ABM	500 ng	EUR 603

SUMF2 Protein Vector (Mouse) (pPB-N-His)
PV235263	ABM	500 ng	EUR 603

SUMF2 Protein Vector (Mouse) (pPM-C-HA)
PV235264	ABM	500 ng	EUR 603

SUMF2 Protein Vector (Mouse) (pPM-C-His)
PV235265	ABM	500 ng	EUR 603

Sumf2 3'UTR Luciferase Stable Cell Line
TU119944	ABM	1.0 ml	Ask for price

Sumf2 3'UTR GFP Stable Cell Line
TU169944	ABM	1.0 ml	Ask for price

Sumf2 3'UTR Luciferase Stable Cell Line
TU221405	ABM	1.0 ml	Ask for price

SUMF2 3'UTR GFP Stable Cell Line
TU074924	ABM	1.0 ml	EUR 2333

Sumf2 3'UTR GFP Stable Cell Line
TU271405	ABM	1.0 ml	Ask for price

SUMF2 3'UTR Luciferase Stable Cell Line
TU024924	ABM	1.0 ml	EUR 2333

Bovine Sulfatase- modifying factor 2, SUMF2 ELISA KIT
ELI-29910b	Lifescience Market	96 Tests	EUR 928

Mouse Sulfatase- modifying factor 2, Sumf2 ELISA KIT
ELI-53384m	Lifescience Market	96 Tests	EUR 865

Human Sulfatase Modifying Factor 2 (SUMF2) ELISA Kit
abx383568-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

SUMF2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV715575	ABM	1.0 ug DNA	EUR 316