TECTB

TECTB siRNA
20-abx936451	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

TECTB siRNA
20-abx936452	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

TECTB cloning plasmid
CSB-CL857003HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 990 Sequence: atggtgacgaaggcctttgtcttgttggccatctttgcagaagcctctgcaaaatcgtgtgctccaaataaagcagatgtcattcttgtgttttgctatcccaaaaccatcatcaccaaaatccccgagtgtccctatggatgggaagttcatcagctggccctcggagggctgtg Show more
Description: A cloning plasmid for the TECTB gene.

TECTB cloning plasmid
CSB-CL857003HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 990 Sequence: atggtgacgaaggcctttgtcttgttggccatctttgcagaagcctctgcaaaatcgtgtgctccaaataaagcagatgtcattcttgtgttttgctatcccaaaaccatcatcaccaaaatccccgagtgtccctatggatgggaagttcatcagctggccctcggagggctgtg Show more
Description: A cloning plasmid for the TECTB gene.

TECTB Antibody, HRP conjugated
1-CSB-PA857003LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TECTB. Recognizes TECTB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TECTB Antibody, FITC conjugated
1-CSB-PA857003LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TECTB. Recognizes TECTB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TECTB Antibody, Biotin conjugated
1-CSB-PA857003LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TECTB. Recognizes TECTB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Tectorin Beta (TECTb) Antibody
20-abx130462	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	0 1 2 3 4
Shipped within 5-7 working days.

Mouse TECTB shRNA Plasmid
20-abx973059	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human TECTB shRNA Plasmid
20-abx954770	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse Beta-tectorin (Tectb)
1-CSB-CF023371MO	Cusabio	EUR 965.00 EUR 665.00 EUR 715.00	0 1 2
MW: 36.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Beta-tectorin(Tectb) expressed in in vitro E.coli expression system

TECTB Recombinant Protein (Rat)
RP232739	ABM	100 ug	Ask for price

Recombinant Tectorin Beta (TECTb)
4-RPC951Hu01	Cloud-Clone	EUR 553.38 EUR 251.00 EUR 1800.16 EUR 666.72 EUR 1233.44 EUR 433.00 EUR 4350.40	0 1 2 3 4 5 6
Uniprot ID: Q96PL2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 38.9kDa Isoelectric Point: Inquire
Description: Recombinant Human Tectorin Beta expressed in: E.coli

TECTB Recombinant Protein (Human)
RP044068	ABM	100 ug	Ask for price

TECTB Recombinant Protein (Human)
RP044071	ABM	100 ug	Ask for price

TECTB Recombinant Protein (Mouse)
RP178136	ABM	100 ug	Ask for price

Human Tectorin Beta (TECTb) Protein
20-abx650244	Abbexa	EUR 773.00 EUR 300.00 EUR 2416.00 EUR 913.00 EUR 537.00	0 1 2 3 4
Shipped within 5-7 working days.

Tectb ORF Vector (Rat) (pORF)
ORF077581	ABM	1.0 ug DNA	EUR 506.00

TECTB ORF Vector (Human) (pORF)
ORF014690	ABM	1.0 ug DNA	EUR 354.00

TECTB ORF Vector (Human) (pORF)
ORF014691	ABM	1.0 ug DNA	EUR 354.00

Tectb ORF Vector (Mouse) (pORF)
ORF059380	ABM	1.0 ug DNA	EUR 506.00

Human β tectorin(TECTB) ELISA kit
E01B0978-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β tectorin(TECTB) ELISA kit
E01B0978-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β tectorin(TECTB) ELISA kit
E01B0978-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β tectorin(TECTB) ELISA kit
E03B0978-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β tectorin(TECTB) ELISA kit
E03B0978-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β tectorin(TECTB) ELISA kit
E03B0978-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β tectorin(TECTB) ELISA kit
E06B0978-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β tectorin(TECTB) ELISA kit
E06B0978-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β tectorin(TECTB) ELISA kit
E06B0978-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β tectorin(TECTB) ELISA kit
E04B0978-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β tectorin(TECTB) ELISA kit
E04B0978-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β tectorin(TECTB) ELISA kit
E04B0978-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β tectorin(TECTB) ELISA kit
E02B0978-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β tectorin(TECTB) ELISA kit
E02B0978-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β tectorin(TECTB) ELISA kit
E02B0978-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β tectorin(TECTB) ELISA kit
E09B0978-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β tectorin(TECTB) ELISA kit
E09B0978-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β tectorin(TECTB) ELISA kit
E09B0978-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β tectorin(TECTB) ELISA kit
E08B0978-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β tectorin(TECTB) ELISA kit
E08B0978-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β tectorin(TECTB) ELISA kit
E08B0978-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β tectorin(TECTB) ELISA kit
E07B0978-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β tectorin(TECTB) ELISA kit
E07B0978-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β tectorin(TECTB) ELISA kit
E07B0978-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta- tectorin, TECTB ELISA KIT
ELI-16202h	Lifescience Market	96 Tests	EUR 824.00

Mouse Beta- tectorin, Tectb ELISA KIT
ELI-41841m	Lifescience Market	96 Tests	EUR 865.00

Chicken Beta- tectorin, TECTB ELISA KIT
ELI-37090c	Lifescience Market	96 Tests	EUR 928.00

Tectb sgRNA CRISPR Lentivector set (Rat)
K6461501	ABM	3 x 1.0 ug	EUR 339.00

Tectb sgRNA CRISPR Lentivector set (Mouse)
K3798001	ABM	3 x 1.0 ug	EUR 339.00

TECTB sgRNA CRISPR Lentivector set (Human)
K2356201	ABM	3 x 1.0 ug	EUR 339.00

Tectorin Beta (TECTb) Polyclonal Antibody (Human)
4-PAC951Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	0 1 2 3 4
Sequence of the immunogen: TECTb (Lys18~Leu329) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tectorin Beta (TECTb)

Human Tectorin Beta(TECTb)ELISA Kit
QY-E03464	Qayee Biotechnology	96T	EUR 394.00

Guinea pig β tectorin(TECTB) ELISA kit
E05B0978-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig β tectorin(TECTB) ELISA kit
E05B0978-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig β tectorin(TECTB) ELISA kit
E05B0978-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β tectorin(TECTB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Tectb sgRNA CRISPR Lentivector (Rat) (Target 1)
K6461502	ABM	1.0 ug DNA	EUR 154.00

Tectb sgRNA CRISPR Lentivector (Rat) (Target 2)
K6461503	ABM	1.0 ug DNA	EUR 154.00

Tectb sgRNA CRISPR Lentivector (Rat) (Target 3)
K6461504	ABM	1.0 ug DNA	EUR 154.00

Tectb sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3798002	ABM	1.0 ug DNA	EUR 154.00

Tectb sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3798003	ABM	1.0 ug DNA	EUR 154.00

Tectb sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3798004	ABM	1.0 ug DNA	EUR 154.00

TECTB sgRNA CRISPR Lentivector (Human) (Target 1)
K2356202	ABM	1.0 ug DNA	EUR 154.00

TECTB sgRNA CRISPR Lentivector (Human) (Target 2)
K2356203	ABM	1.0 ug DNA	EUR 154.00

TECTB sgRNA CRISPR Lentivector (Human) (Target 3)
K2356204	ABM	1.0 ug DNA	EUR 154.00

Tectorin Beta (TECTb) Polyclonal Antibody (Human), APC
4-PAC951Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	0 1 2 3 4
Sequence of the immunogen: TECTb (Lys18~Leu329) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tectorin Beta (TECTb). This antibody is labeled with APC.

Tectorin Beta (TECTb) Polyclonal Antibody (Human), Biotinylated
4-PAC951Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	0 1 2 3 4
Sequence of the immunogen: TECTb (Lys18~Leu329) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tectorin Beta (TECTb). This antibody is labeled with Biotin.

Tectorin Beta (TECTb) Polyclonal Antibody (Human), Cy3
4-PAC951Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	0 1 2 3 4
Sequence of the immunogen: TECTb (Lys18~Leu329) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tectorin Beta (TECTb). This antibody is labeled with Cy3.

Tectorin Beta (TECTb) Polyclonal Antibody (Human), FITC
4-PAC951Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	0 1 2 3 4
Sequence of the immunogen: TECTb (Lys18~Leu329) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tectorin Beta (TECTb). This antibody is labeled with FITC.

Tectorin Beta (TECTb) Polyclonal Antibody (Human), HRP
4-PAC951Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	0 1 2 3 4
Sequence of the immunogen: TECTb (Lys18~Leu329) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tectorin Beta (TECTb). This antibody is labeled with HRP.

Tectorin Beta (TECTb) Polyclonal Antibody (Human), PE
4-PAC951Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	0 1 2 3 4
Sequence of the immunogen: TECTb (Lys18~Leu329) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tectorin Beta (TECTb). This antibody is labeled with PE.

TECTB Protein Vector (Rat) (pPB-C-His)
PV310322	ABM	500 ng	EUR 603.00

TECTB Protein Vector (Rat) (pPB-N-His)
PV310323	ABM	500 ng	EUR 603.00

TECTB Protein Vector (Rat) (pPM-C-HA)
PV310324	ABM	500 ng	EUR 603.00

TECTB Protein Vector (Rat) (pPM-C-His)
PV310325	ABM	500 ng	EUR 603.00