In den Nachrichten

TFPT

TFPT siRNA
20-abx905540
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TFPT siRNA
20-abx936600
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TFPT siRNA
20-abx936601
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TFPT antibody
70R-20790 50 ul
EUR 435.00
Description: Rabbit polyclonal TFPT antibody
TFPT antibody
38938-100ul 100ul
EUR 252.00
TFPT Antibody
1-CSB-PA023439GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TFPT. Recognizes TFPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
pOTB7-TFPT
PVT19038 2 ug
EUR 231.00
TFPT Conjugated Antibody
C38938 100ul
EUR 397.00
TFPT cloning plasmid
CSB-CL023439HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 762
  • Sequence: atggaattggagcagagagaagggaccatggcagccgtgggctttgaggagttctcagcgccgccaggctcagagttggcgttgcctcccctatttggtggccacatcctggagagcgagctggagacggaagtggagtttgtgtcaggtggtctgggcggctcagggctccggga
  • Show more
Description: A cloning plasmid for the TFPT gene.
TFPT cloning plasmid
CSB-CL023439HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 735
  • Sequence: atggcagccgtgggctttgaggagttctcagcgccgccaggctcagagttggcgttgcctcccctatttggtggccacatcctggagagcgagctggagacggaagtggagtttgtgtcaggtggtctgggcggctcagggctccgggagcgagatgaagaggaagaggcagcccg
  • Show more
Description: A cloning plasmid for the TFPT gene.
anti- TFPT antibody
FNab08635 100µg
EUR 548.75
  • Immunogen: TCF3(E2A) fusion partner(in childhood Leukemia)
  • Uniprot ID: P0C1Z6
  • Gene ID: 29844
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against TFPT
TFPT Rabbit pAb
A6461-100ul 100 ul
EUR 308.00
TFPT Rabbit pAb
A6461-200ul 200 ul
EUR 459.00
TFPT Rabbit pAb
A6461-20ul 20 ul
EUR 183.00
TFPT Rabbit pAb
A6461-50ul 50 ul
EUR 223.00
Anti-TFPT antibody
PAab08635 100 ug
EUR 386.00
Anti-TFPT antibody
STJ28544 100 µl
EUR 277.00
Mouse TFPT shRNA Plasmid
20-abx977029
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Rat TFPT shRNA Plasmid
20-abx987022
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
TFPT ELISA KIT|Human
EF003563 96 Tests
EUR 689.00
Human TFPT shRNA Plasmid
20-abx959239
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
TFPT Recombinant Protein (Human)
RP031372 100 ug Ask for price
TFPT Recombinant Protein (Human)
RP031375 100 ug Ask for price
TFPT Recombinant Protein (Rat)
RP232910 100 ug Ask for price
TFPT Recombinant Protein (Mouse)
RP178406 100 ug Ask for price
TCF3 Fusion Partner (TFPT) Antibody
abx034315-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
TCF3 Fusion Partner (TFPT) Antibody
abx034315-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
TCF3 Fusion Partner (TFPT) Antibody
20-abx004953
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
TCF3 Fusion Partner (TFPT) Antibody
abx238635-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
Tfpt ORF Vector (Mouse) (pORF)
ORF059470 1.0 ug DNA
EUR 506.00
TFPT ORF Vector (Human) (pORF)
ORF010458 1.0 ug DNA
EUR 95.00
TFPT ORF Vector (Human) (pORF)
ORF010459 1.0 ug DNA
EUR 95.00
Tfpt ORF Vector (Rat) (pORF)
ORF077638 1.0 ug DNA
EUR 506.00
Polyclonal TFPT antibody - C-terminal region
APR01604G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TFPT - C-terminal region. This antibody is tested and proven to work in the following applications:
TFPT sgRNA CRISPR Lentivector set (Human)
K2363501 3 x 1.0 ug
EUR 339.00
Tfpt sgRNA CRISPR Lentivector set (Mouse)
K4652201 3 x 1.0 ug
EUR 339.00
Tfpt sgRNA CRISPR Lentivector set (Rat)
K6972001 3 x 1.0 ug
EUR 339.00
Human TCF3 fusion partner, TFPT ELISA KIT
ELI-37062h 96 Tests
EUR 824.00
Human TCF3 Fusion Partner (TFPT) ELISA Kit
abx383724-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.
TFPT sgRNA CRISPR Lentivector (Human) (Target 1)
K2363502 1.0 ug DNA
EUR 154.00
TFPT sgRNA CRISPR Lentivector (Human) (Target 2)
K2363503 1.0 ug DNA
EUR 154.00
TFPT sgRNA CRISPR Lentivector (Human) (Target 3)
K2363504 1.0 ug DNA
EUR 154.00
Tfpt sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4652202 1.0 ug DNA
EUR 154.00
Tfpt sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4652203 1.0 ug DNA
EUR 154.00
Tfpt sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4652204 1.0 ug DNA
EUR 154.00
Tfpt sgRNA CRISPR Lentivector (Rat) (Target 1)
K6972002 1.0 ug DNA
EUR 154.00
Tfpt sgRNA CRISPR Lentivector (Rat) (Target 2)
K6972003 1.0 ug DNA
EUR 154.00
Tfpt sgRNA CRISPR Lentivector (Rat) (Target 3)
K6972004 1.0 ug DNA
EUR 154.00
TFPT Protein Vector (Human) (pPB-C-His)
PV041829 500 ng
EUR 329.00
TFPT Protein Vector (Human) (pPB-N-His)
PV041830 500 ng
EUR 329.00
TFPT Protein Vector (Human) (pPM-C-HA)
PV041831 500 ng
EUR 329.00
TFPT Protein Vector (Human) (pPM-C-His)
PV041832 500 ng
EUR 329.00
TFPT Protein Vector (Human) (pPB-C-His)
PV041833 500 ng
EUR 329.00
TFPT Protein Vector (Human) (pPB-N-His)
PV041834 500 ng
EUR 329.00
TFPT Protein Vector (Human) (pPM-C-HA)
PV041835 500 ng
EUR 329.00
TFPT Protein Vector (Human) (pPM-C-His)
PV041836 500 ng
EUR 329.00
TFPT Protein Vector (Rat) (pPB-C-His)
PV310550 500 ng
EUR 603.00
TFPT Protein Vector (Rat) (pPB-N-His)
PV310551 500 ng
EUR 603.00
TFPT Protein Vector (Rat) (pPM-C-HA)
PV310552 500 ng
EUR 603.00
TFPT Protein Vector (Rat) (pPM-C-His)
PV310553 500 ng
EUR 603.00
TFPT Protein Vector (Mouse) (pPB-C-His)
PV237878 500 ng
EUR 603.00
TFPT Protein Vector (Mouse) (pPB-N-His)
PV237879 500 ng
EUR 603.00
TFPT Protein Vector (Mouse) (pPM-C-HA)
PV237880 500 ng
EUR 603.00
TFPT Protein Vector (Mouse) (pPM-C-His)
PV237881 500 ng
EUR 603.00
Tfpt 3'UTR GFP Stable Cell Line
TU170405 1.0 ml Ask for price
TFPT 3'UTR GFP Stable Cell Line
TU075474 1.0 ml
EUR 1394.00
Tfpt 3'UTR Luciferase Stable Cell Line
TU120405 1.0 ml Ask for price
TFPT 3'UTR Luciferase Stable Cell Line
TU025474 1.0 ml
EUR 1394.00
Tfpt 3'UTR Luciferase Stable Cell Line
TU221815 1.0 ml Ask for price
Tfpt 3'UTR GFP Stable Cell Line
TU271815 1.0 ml Ask for price
Bovine TCF3 fusion partner homolog, TFPT ELISA KIT
ELI-18981b 96 Tests
EUR 928.00
Mouse TCF3 fusion partner homolog, Tfpt ELISA KIT
ELI-41794m 96 Tests
EUR 865.00
TFPT Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV715803 1.0 ug DNA
EUR 316.00
TFPT Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV715807 1.0 ug DNA
EUR 316.00
TFPT Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV715808 1.0 ug DNA
EUR 316.00