TFPT antibody
70R-20790	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal TFPT antibody

TFPT antibody
38938-100ul	SAB	100ul	EUR 252.00

TFPT Antibody
1-CSB-PA023439GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TFPT. Recognizes TFPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TFPT siRNA
20-abx905540	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

TFPT siRNA
20-abx936600	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

TFPT siRNA
20-abx936601	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

pOTB7-TFPT
PVT19038	Lifescience Market	2 ug	EUR 231.00

TFPT Conjugated Antibody
C38938	SAB	100ul	EUR 397.00

TFPT cloning plasmid
CSB-CL023439HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 762 Sequence: atggaattggagcagagagaagggaccatggcagccgtgggctttgaggagttctcagcgccgccaggctcagagttggcgttgcctcccctatttggtggccacatcctggagagcgagctggagacggaagtggagtttgtgtcaggtggtctgggcggctcagggctccggga Show more
Description: A cloning plasmid for the TFPT gene.

TFPT cloning plasmid
CSB-CL023439HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 735 Sequence: atggcagccgtgggctttgaggagttctcagcgccgccaggctcagagttggcgttgcctcccctatttggtggccacatcctggagagcgagctggagacggaagtggagtttgtgtcaggtggtctgggcggctcagggctccgggagcgagatgaagaggaagaggcagcccg Show more
Description: A cloning plasmid for the TFPT gene.

TFPT Rabbit pAb
A6461-100ul	Abclonal	100 ul	EUR 308.00

TFPT Rabbit pAb
A6461-200ul	Abclonal	200 ul	EUR 459.00

TFPT Rabbit pAb
A6461-20ul	Abclonal	20 ul	EUR 183.00

TFPT Rabbit pAb
A6461-50ul	Abclonal	50 ul	EUR 223.00

anti- TFPT antibody
FNab08635	FN Test	100µg	EUR 548.75
Immunogen: TCF3(E2A) fusion partner(in childhood Leukemia) Uniprot ID: P0C1Z6 Gene ID: 29844 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against TFPT

Anti-TFPT antibody
PAab08635	Lifescience Market	100 ug	EUR 386.00

Anti-TFPT antibody
STJ28544	St John's Laboratory	100 µl	EUR 277.00

TFPT ELISA KIT|Human
EF003563	Lifescience Market	96 Tests	EUR 689.00

Mouse TFPT shRNA Plasmid
20-abx977029	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat TFPT shRNA Plasmid
20-abx987022	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human TFPT shRNA Plasmid
20-abx959239	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

TFPT Recombinant Protein (Rat)
RP232910	ABM	100 ug	Ask for price

TFPT Recombinant Protein (Human)
RP031372	ABM	100 ug	Ask for price

TFPT Recombinant Protein (Human)
RP031375	ABM	100 ug	Ask for price

TFPT Recombinant Protein (Mouse)
RP178406	ABM	100 ug	Ask for price

TCF3 Fusion Partner (TFPT) Antibody
20-abx004953	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

TCF3 Fusion Partner (TFPT) Antibody
abx034315-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

TCF3 Fusion Partner (TFPT) Antibody
abx034315-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

TCF3 Fusion Partner (TFPT) Antibody
abx238635-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Tfpt ORF Vector (Rat) (pORF)
ORF077638	ABM	1.0 ug DNA	EUR 506.00

TFPT ORF Vector (Human) (pORF)
ORF010458	ABM	1.0 ug DNA	EUR 95.00

TFPT ORF Vector (Human) (pORF)
ORF010459	ABM	1.0 ug DNA	EUR 95.00

Tfpt ORF Vector (Mouse) (pORF)
ORF059470	ABM	1.0 ug DNA	EUR 506.00

Polyclonal TFPT antibody - C-terminal region
APR01604G	Leading Biology	0.05mg	EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TFPT - C-terminal region. This antibody is tested and proven to work in the following applications:

Tfpt sgRNA CRISPR Lentivector set (Mouse)
K4652201	ABM	3 x 1.0 ug	EUR 339.00

Tfpt sgRNA CRISPR Lentivector set (Rat)
K6972001	ABM	3 x 1.0 ug	EUR 339.00

TFPT sgRNA CRISPR Lentivector set (Human)
K2363501	ABM	3 x 1.0 ug	EUR 339.00

Human TCF3 Fusion Partner (TFPT) ELISA Kit
abx383724-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Human TCF3 fusion partner, TFPT ELISA KIT
ELI-37062h	Lifescience Market	96 Tests	EUR 824.00

Tfpt sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4652202	ABM	1.0 ug DNA	EUR 154.00

Tfpt sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4652203	ABM	1.0 ug DNA	EUR 154.00

Tfpt sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4652204	ABM	1.0 ug DNA	EUR 154.00

Tfpt sgRNA CRISPR Lentivector (Rat) (Target 1)
K6972002	ABM	1.0 ug DNA	EUR 154.00

Tfpt sgRNA CRISPR Lentivector (Rat) (Target 2)
K6972003	ABM	1.0 ug DNA	EUR 154.00

Tfpt sgRNA CRISPR Lentivector (Rat) (Target 3)
K6972004	ABM	1.0 ug DNA	EUR 154.00

TFPT sgRNA CRISPR Lentivector (Human) (Target 1)
K2363502	ABM	1.0 ug DNA	EUR 154.00

TFPT sgRNA CRISPR Lentivector (Human) (Target 2)
K2363503	ABM	1.0 ug DNA	EUR 154.00

TFPT sgRNA CRISPR Lentivector (Human) (Target 3)
K2363504	ABM	1.0 ug DNA	EUR 154.00

TFPT Protein Vector (Rat) (pPB-C-His)
PV310550	ABM	500 ng	EUR 603.00

TFPT Protein Vector (Rat) (pPB-N-His)
PV310551	ABM	500 ng	EUR 603.00

TFPT Protein Vector (Rat) (pPM-C-HA)
PV310552	ABM	500 ng	EUR 603.00

TFPT Protein Vector (Rat) (pPM-C-His)
PV310553	ABM	500 ng	EUR 603.00

TFPT Protein Vector (Human) (pPB-C-His)
PV041829	ABM	500 ng	EUR 329.00

TFPT Protein Vector (Human) (pPB-N-His)
PV041830	ABM	500 ng	EUR 329.00

TFPT Protein Vector (Human) (pPM-C-HA)
PV041831	ABM	500 ng	EUR 329.00

TFPT Protein Vector (Human) (pPM-C-His)
PV041832	ABM	500 ng	EUR 329.00

TFPT Protein Vector (Human) (pPB-C-His)
PV041833	ABM	500 ng	EUR 329.00

TFPT Protein Vector (Human) (pPB-N-His)
PV041834	ABM	500 ng	EUR 329.00

TFPT Protein Vector (Human) (pPM-C-HA)
PV041835	ABM	500 ng	EUR 329.00

TFPT Protein Vector (Human) (pPM-C-His)
PV041836	ABM	500 ng	EUR 329.00

TFPT Protein Vector (Mouse) (pPB-C-His)
PV237878	ABM	500 ng	EUR 603.00

TFPT Protein Vector (Mouse) (pPB-N-His)
PV237879	ABM	500 ng	EUR 603.00

TFPT Protein Vector (Mouse) (pPM-C-HA)
PV237880	ABM	500 ng	EUR 603.00

TFPT Protein Vector (Mouse) (pPM-C-His)
PV237881	ABM	500 ng	EUR 603.00

Tfpt 3'UTR Luciferase Stable Cell Line
TU120405	ABM	1.0 ml	Ask for price

Tfpt 3'UTR GFP Stable Cell Line
TU170405	ABM	1.0 ml	Ask for price

Tfpt 3'UTR Luciferase Stable Cell Line
TU221815	ABM	1.0 ml	Ask for price

TFPT 3'UTR GFP Stable Cell Line
TU075474	ABM	1.0 ml	EUR 1394.00

Tfpt 3'UTR GFP Stable Cell Line
TU271815	ABM	1.0 ml	Ask for price

TFPT 3'UTR Luciferase Stable Cell Line
TU025474	ABM	1.0 ml	EUR 1394.00

Bovine TCF3 fusion partner homolog, TFPT ELISA KIT
ELI-18981b	Lifescience Market	96 Tests	EUR 928.00

TFPT Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV715803	ABM	1.0 ug DNA	EUR 316.00

TFPT Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV715807	ABM	1.0 ug DNA	EUR 316.00

TFPT Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV715808	ABM	1.0 ug DNA	EUR 316.00

Mouse TCF3 fusion partner homolog, Tfpt ELISA KIT
ELI-41794m	Lifescience Market	96 Tests	EUR 865.00