THSD1 Antibody
1-CSB-PA776650
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against THSD1. Recognizes THSD1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
THSD1 Antibody
1-CSB-PA038075
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against THSD1. Recognizes THSD1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
THSD1 siRNA
20-abx936729
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
THSD1 siRNA
20-abx936730
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
THSD1 Conjugated Antibody
C40145 100ul
EUR 397
THSD1 cloning plasmid
CSB-CL873644HU-10ug 10ug
EUR 782
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2400
  • Sequence: atgaaaccaatgttgaaagacttttcaaatctattgttggtggtactctgtgactatgttcttggagaagctgaatatcttctcttgagagagccaggccatgtagcactaagcaacgacacagtgtatgtggatttccagtattttgatggtgctaatgggacactgaggaatg
  • Show more
Description: A cloning plasmid for the THSD1 gene.
Human THSD1 ELISA KIT
ELI-52041h 96 Tests
EUR 824
Mouse Thsd1 ELISA KIT
ELI-52042m 96 Tests
EUR 865
Mouse THSD1 shRNA Plasmid
20-abx974663
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human THSD1 shRNA Plasmid
20-abx961000
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Bovine THSD1 ELISA KIT
ELI-40004b 96 Tests
EUR 928
Recombinant Human THSD1 Protein
RP00253 5 μg
EUR 136
Thsd1 ORF Vector (Rat) (pORF)
ORF077690 1.0 ug DNA
EUR 506
THSD1 ORF Vector (Human) (pORF)
ORF010504 1.0 ug DNA
EUR 95
Thsd1 ORF Vector (Mouse) (pORF)
ORF059549 1.0 ug DNA
EUR 506
Thsd1 ORF Vector (Mouse) (pORF)
ORF059550 1.0 ug DNA
EUR 506
Recombinant Human THSD1/TMTSP (C-6His)
C646-10ug 10ug
EUR 90
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.
Recombinant Human THSD1/TMTSP (C-6His)
C646-1mg 1mg
EUR 1166
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.
Recombinant Human THSD1/TMTSP (C-6His)
C646-500ug 500ug
EUR 831
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.
Recombinant Human THSD1/TMTSP (C-6His)
C646-50ug 50ug
EUR 171
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.
Thsd1 sgRNA CRISPR Lentivector set (Rat)
K6551501 3 x 1.0 ug
EUR 339
Thsd1 sgRNA CRISPR Lentivector set (Mouse)
K3693001 3 x 1.0 ug
EUR 339
THSD1 sgRNA CRISPR Lentivector set (Human)
K2371401 3 x 1.0 ug
EUR 339
Thsd1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6551502 1.0 ug DNA
EUR 154
Thsd1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6551503 1.0 ug DNA
EUR 154
Thsd1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6551504 1.0 ug DNA
EUR 154
Thsd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3693002 1.0 ug DNA
EUR 154
Thsd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3693003 1.0 ug DNA
EUR 154
Thsd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3693004 1.0 ug DNA
EUR 154
THSD1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2371402 1.0 ug DNA
EUR 154
THSD1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2371403 1.0 ug DNA
EUR 154
THSD1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2371404 1.0 ug DNA
EUR 154
THSD1 Protein Vector (Rat) (pPB-C-His)
PV310758 500 ng
EUR 1191
THSD1 Protein Vector (Rat) (pPB-N-His)
PV310759 500 ng
EUR 1191
THSD1 Protein Vector (Rat) (pPM-C-HA)
PV310760 500 ng
EUR 1191
THSD1 Protein Vector (Rat) (pPM-C-His)
PV310761 500 ng
EUR 1191
THSD1 Protein Vector (Human) (pPB-C-His)
PV042013 500 ng
EUR 329
THSD1 Protein Vector (Human) (pPB-N-His)
PV042014 500 ng
EUR 329
THSD1 Protein Vector (Human) (pPM-C-HA)
PV042015 500 ng
EUR 329
THSD1 Protein Vector (Human) (pPM-C-His)
PV042016 500 ng
EUR 329
THSD1 Protein Vector (Mouse) (pPB-C-His)
PV238194 500 ng
EUR 1065
THSD1 Protein Vector (Mouse) (pPB-N-His)
PV238195 500 ng
EUR 1065
THSD1 Protein Vector (Mouse) (pPM-C-HA)
PV238196 500 ng
EUR 1065
THSD1 Protein Vector (Mouse) (pPM-C-His)
PV238197 500 ng
EUR 1065
THSD1 Protein Vector (Mouse) (pPB-C-His)
PV238198 500 ng
EUR 1065
THSD1 Protein Vector (Mouse) (pPB-N-His)
PV238199 500 ng
EUR 1065
THSD1 Protein Vector (Mouse) (pPM-C-HA)
PV238200 500 ng
EUR 1065
THSD1 Protein Vector (Mouse) (pPM-C-His)
PV238201 500 ng
EUR 1065
Thsd1 3'UTR Luciferase Stable Cell Line
TU120470 1.0 ml Ask for price
Thsd1 3'UTR GFP Stable Cell Line
TU170470 1.0 ml Ask for price
Thsd1 3'UTR Luciferase Stable Cell Line
TU221871 1.0 ml Ask for price
THSD1 3'UTR GFP Stable Cell Line
TU075554 1.0 ml
EUR 1394
Thsd1 3'UTR GFP Stable Cell Line
TU271871 1.0 ml Ask for price
THSD1 3'UTR Luciferase Stable Cell Line
TU025554 1.0 ml
EUR 1394
Thrombospondin Type 1 Domain Containing 1 (THSD1) Antibody
20-abx212683
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thrombospondin Type 1 Domain Containing 1 (THSD1) Antibody
20-abx212684
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thrombospondin Type 1 Domain Containing 1 (THSD1) Antibody
abx122859-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
THSD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV649783 1.0 ug DNA
EUR 1355
THSD1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV649787 1.0 ug DNA
EUR 1355
THSD1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV649788 1.0 ug DNA
EUR 1355
Thsd1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6551505 3 x 1.0 ug
EUR 376
Thsd1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3693005 3 x 1.0 ug
EUR 376
THSD1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2371405 3 x 1.0 ug
EUR 376
THSD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV649784 1.0 ug DNA
EUR 1355
THSD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV649785 1.0 ug DNA
EUR 1413
THSD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV649786 1.0 ug DNA
EUR 1413
Thsd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6551506 1.0 ug DNA
EUR 167
Thsd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6551507 1.0 ug DNA
EUR 167
Thsd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6551508 1.0 ug DNA
EUR 167
Thsd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3693006 1.0 ug DNA
EUR 167
Thsd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3693007 1.0 ug DNA
EUR 167
Thsd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3693008 1.0 ug DNA
EUR 167
THSD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2371406 1.0 ug DNA
EUR 167
THSD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2371407 1.0 ug DNA
EUR 167
THSD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2371408 1.0 ug DNA
EUR 167