TIMM8B

TIMM8B siRNA
20-abx905582	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TIMM8B siRNA
20-abx936814	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TIMM8B siRNA
20-abx936815	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TIMM8B Antibody
1-CSB-PA897567LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM8B. Recognizes TIMM8B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-TIMM8B
YF-PA26004	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to TIMM8B

TIMM8B Antibody (HRP)
20-abx312551	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TIMM8B Antibody (FITC)
20-abx312552	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TIMM8B Antibody (Biotin)
20-abx312553	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TIMM8B Polyclonal Antibody
A61314	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

TIMM8B Rabbit pAb
A15814-100ul	Abclonal	100 ul	EUR 308

TIMM8B Rabbit pAb
A15814-200ul	Abclonal	200 ul	EUR 459

TIMM8B Rabbit pAb
A15814-20ul	Abclonal	20 ul	EUR 183

TIMM8B Rabbit pAb
A15814-50ul	Abclonal	50 ul	EUR 223

TIMM8B Polyclonal Antibody
29433-100ul	SAB	100ul	EUR 252

TIMM8B Polyclonal Antibody
29433-50ul	SAB	50ul	EUR 187

TIMM8B cloning plasmid
CSB-CL897567HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 156 Sequence: atggagttatgttgggataaatgtgtggagaagccagggaatcgcctagactctcgcactgaaaattgtctctccagctgtgtagaccgcttcattgacaccactcttgccatcaccagtcggtttgcccagattgtacagaaaggagggcagtag
Description: A cloning plasmid for the TIMM8B gene.

Anti-TIMM8B antibody
STJ118273	St John's Laboratory	100 µl	EUR 277

Anti-TIMM8B (2G7)
YF-MA18120	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TIMM8B

Anti-TIMM8B (3C8)
YF-MA18121	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TIMM8B

Anti-TIMM8B (8E5)
YF-MA18122	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TIMM8B

TIMM8B Polyclonal Conjugated Antibody
C29433	SAB	100ul	EUR 397

Mouse TIMM8B shRNA Plasmid
20-abx974019	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat TIMM8B shRNA Plasmid
20-abx986230	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Bovine TIMM8B ELISA KIT
ELI-17160b	Lifescience Market	96 Tests	EUR 928

Mouse Timm8b ELISA KIT
ELI-29217m	Lifescience Market	96 Tests	EUR 865

Human TIMM8B ELISA KIT
ELI-41968h	Lifescience Market	96 Tests	EUR 824

Human TIMM8B shRNA Plasmid
20-abx958846	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TIMM8B Antibody, HRP conjugated
1-CSB-PA897567LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM8B. Recognizes TIMM8B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TIMM8B Antibody, FITC conjugated
1-CSB-PA897567LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM8B. Recognizes TIMM8B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TIMM8B Antibody, Biotin conjugated
1-CSB-PA897567LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM8B. Recognizes TIMM8B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TIMM8B Recombinant Protein (Human)
RP031594	ABM	100 ug	Ask for price

TIMM8B Recombinant Protein (Rat)
RP233162	ABM	100 ug	Ask for price

TIMM8B Recombinant Protein (Mouse)
RP178796	ABM	100 ug	Ask for price

TIMM8B Polyclonal Antibody, Biotin Conjugated
A61315	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

TIMM8B Polyclonal Antibody, FITC Conjugated
A61316	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

TIMM8B Polyclonal Antibody, HRP Conjugated
A61317	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Timm8b ORF Vector (Mouse) (pORF)
ORF059600	ABM	1.0 ug DNA	EUR 506

TIMM8B ORF Vector (Human) (pORF)
ORF010532	ABM	1.0 ug DNA	EUR 95

Timm8b ORF Vector (Rat) (pORF)
ORF077722	ABM	1.0 ug DNA	EUR 506

TIMM8B ELISA Kit (Human) (OKCA01360)
OKCA01360	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Probable mitochondrial intermembrane chaperone that participates in the import and insertion of some multi-pass transmembrane proteins into the mitochondrial inner membrane. Also required for the transfer of beta-barrel precursors from the TOM complex to the sorting and assembly machinery (SAM complex) of the outer membrane. Acts as a chaperone-like protein that protects the hydrophobic precursors from aggregation and guide them through the mitochondrial intermembrane space.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 5.87 pg/mL

TIMM8B sgRNA CRISPR Lentivector set (Human)
K2374801	ABM	3 x 1.0 ug	EUR 339

Timm8b sgRNA CRISPR Lentivector set (Mouse)
K3928001	ABM	3 x 1.0 ug	EUR 339

Timm8b sgRNA CRISPR Lentivector set (Rat)
K7045701	ABM	3 x 1.0 ug	EUR 339

TIMM8B sgRNA CRISPR Lentivector (Human) (Target 1)
K2374802	ABM	1.0 ug DNA	EUR 154

TIMM8B sgRNA CRISPR Lentivector (Human) (Target 2)
K2374803	ABM	1.0 ug DNA	EUR 154

TIMM8B sgRNA CRISPR Lentivector (Human) (Target 3)
K2374804	ABM	1.0 ug DNA	EUR 154

Timm8b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3928002	ABM	1.0 ug DNA	EUR 154

Timm8b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3928003	ABM	1.0 ug DNA	EUR 154

Timm8b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3928004	ABM	1.0 ug DNA	EUR 154

Timm8b sgRNA CRISPR Lentivector (Rat) (Target 1)
K7045702	ABM	1.0 ug DNA	EUR 154

Timm8b sgRNA CRISPR Lentivector (Rat) (Target 2)
K7045703	ABM	1.0 ug DNA	EUR 154

Timm8b sgRNA CRISPR Lentivector (Rat) (Target 3)
K7045704	ABM	1.0 ug DNA	EUR 154

TIMM8B Protein Vector (Human) (pPB-C-His)
PV042125	ABM	500 ng	EUR 329

TIMM8B Protein Vector (Human) (pPB-N-His)
PV042126	ABM	500 ng	EUR 329

TIMM8B Protein Vector (Human) (pPM-C-HA)
PV042127	ABM	500 ng	EUR 329

TIMM8B Protein Vector (Human) (pPM-C-His)
PV042128	ABM	500 ng	EUR 329

TIMM8B Protein Vector (Rat) (pPB-C-His)
PV310886	ABM	500 ng	EUR 603

TIMM8B Protein Vector (Rat) (pPB-N-His)
PV310887	ABM	500 ng	EUR 603

TIMM8B Protein Vector (Rat) (pPM-C-HA)
PV310888	ABM	500 ng	EUR 603

TIMM8B Protein Vector (Rat) (pPM-C-His)
PV310889	ABM	500 ng	EUR 603

TIMM8B Protein Vector (Mouse) (pPB-C-His)
PV238398	ABM	500 ng	EUR 603

TIMM8B Protein Vector (Mouse) (pPB-N-His)
PV238399	ABM	500 ng	EUR 603

TIMM8B Protein Vector (Mouse) (pPM-C-HA)
PV238400	ABM	500 ng	EUR 603

TIMM8B Protein Vector (Mouse) (pPM-C-His)
PV238401	ABM	500 ng	EUR 603

Timm8b 3'UTR GFP Stable Cell Line
TU170507	ABM	1.0 ml	Ask for price

TIMM8B 3'UTR GFP Stable Cell Line
TU075590	ABM	1.0 ml	EUR 1394

Timm8b 3'UTR Luciferase Stable Cell Line
TU120507	ABM	1.0 ml	Ask for price

TIMM8B 3'UTR Luciferase Stable Cell Line
TU025590	ABM	1.0 ml	EUR 1394

Timm8b 3'UTR Luciferase Stable Cell Line
TU221901	ABM	1.0 ml	Ask for price

Timm8b 3'UTR GFP Stable Cell Line
TU271901	ABM	1.0 ml	Ask for price

TIMM8B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV697645	ABM	1.0 ug DNA	EUR 514

TIMM8B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV697649	ABM	1.0 ug DNA	EUR 514

TIMM8B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV697650	ABM	1.0 ug DNA	EUR 514

Mitochondrial Import Inner Membrane Translocase Subunit Tim8 B (TIMM8B) Antibody
20-abx301770	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TIMM8B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2374805	ABM	3 x 1.0 ug	EUR 376