TIMM8B

TIMM8B Antibody
1-CSB-PA897567LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM8B. Recognizes TIMM8B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
TIMM8B siRNA
20-abx905582
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TIMM8B siRNA
20-abx936814
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TIMM8B siRNA
20-abx936815
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
anti-TIMM8B
YF-PA26004 50 ul
EUR 334.00
Description: Mouse polyclonal to TIMM8B
TIMM8B Polyclonal Antibody
29433-100ul 100ul
EUR 252.00
TIMM8B Polyclonal Antibody
29433-50ul 50ul
EUR 187.00
TIMM8B Rabbit pAb
A15814-100ul 100 ul
EUR 308.00
TIMM8B Rabbit pAb
A15814-200ul 200 ul
EUR 459.00
TIMM8B Rabbit pAb
A15814-20ul 20 ul
EUR 183.00
TIMM8B Rabbit pAb
A15814-50ul 50 ul
EUR 223.00
TIMM8B cloning plasmid
CSB-CL897567HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 156
  • Sequence: atggagttatgttgggataaatgtgtggagaagccagggaatcgcctagactctcgcactgaaaattgtctctccagctgtgtagaccgcttcattgacaccactcttgccatcaccagtcggtttgcccagattgtacagaaaggagggcagtag
Description: A cloning plasmid for the TIMM8B gene.
TIMM8B Antibody (HRP)
20-abx312551
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
TIMM8B Antibody (FITC)
20-abx312552
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
TIMM8B Antibody (Biotin)
20-abx312553
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
TIMM8B Polyclonal Antibody
A61314 100 µg
EUR 570.55
Description: kits suitable for this type of research
Anti-TIMM8B antibody
STJ118273 100 µl
EUR 277.00
Anti-TIMM8B (2G7)
YF-MA18120 100 ug
EUR 363.00
Description: Mouse monoclonal to TIMM8B
Anti-TIMM8B (3C8)
YF-MA18121 100 ug
EUR 363.00
Description: Mouse monoclonal to TIMM8B
Anti-TIMM8B (8E5)
YF-MA18122 100 ug
EUR 363.00
Description: Mouse monoclonal to TIMM8B
TIMM8B Antibody, HRP conjugated
1-CSB-PA897567LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM8B. Recognizes TIMM8B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TIMM8B Antibody, FITC conjugated
1-CSB-PA897567LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM8B. Recognizes TIMM8B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TIMM8B Antibody, Biotin conjugated
1-CSB-PA897567LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM8B. Recognizes TIMM8B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Bovine TIMM8B ELISA KIT
ELI-17160b 96 Tests
EUR 928.00
Mouse Timm8b ELISA KIT
ELI-29217m 96 Tests
EUR 865.00
Mouse TIMM8B shRNA Plasmid
20-abx974019
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Rat TIMM8B shRNA Plasmid
20-abx986230
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
TIMM8B Polyclonal Conjugated Antibody
C29433 100ul
EUR 397.00
Human TIMM8B shRNA Plasmid
20-abx958846
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human TIMM8B ELISA KIT
ELI-41968h 96 Tests
EUR 824.00
TIMM8B Recombinant Protein (Rat)
RP233162 100 ug Ask for price
TIMM8B Recombinant Protein (Human)
RP031594 100 ug Ask for price
TIMM8B Recombinant Protein (Mouse)
RP178796 100 ug Ask for price
TIMM8B Polyclonal Antibody, Biotin Conjugated
A61315 100 µg
EUR 570.55
Description: fast delivery possible
TIMM8B Polyclonal Antibody, FITC Conjugated
A61316 100 µg
EUR 570.55
Description: reagents widely cited
TIMM8B Polyclonal Antibody, HRP Conjugated
A61317 100 µg
EUR 570.55
Description: Ask the seller for details
Timm8b ORF Vector (Rat) (pORF)
ORF077722 1.0 ug DNA
EUR 506.00
TIMM8B ORF Vector (Human) (pORF)
ORF010532 1.0 ug DNA
EUR 95.00
Timm8b ORF Vector (Mouse) (pORF)
ORF059600 1.0 ug DNA
EUR 506.00
TIMM8B ELISA Kit (Human) (OKCA01360)
OKCA01360 96 Wells
EUR 846.00
Description: Description of target: Probable mitochondrial intermembrane chaperone that participates in the import and insertion of some multi-pass transmembrane proteins into the mitochondrial inner membrane. Also required for the transfer of beta-barrel precursors from the TOM complex to the sorting and assembly machinery (SAM complex) of the outer membrane. Acts as a chaperone-like protein that protects the hydrophobic precursors from aggregation and guide them through the mitochondrial intermembrane space.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 5.87 pg/mL
Timm8b sgRNA CRISPR Lentivector set (Rat)
K7045701 3 x 1.0 ug
EUR 339.00
Timm8b sgRNA CRISPR Lentivector set (Mouse)
K3928001 3 x 1.0 ug
EUR 339.00
TIMM8B sgRNA CRISPR Lentivector set (Human)
K2374801 3 x 1.0 ug
EUR 339.00
Timm8b sgRNA CRISPR Lentivector (Rat) (Target 1)
K7045702 1.0 ug DNA
EUR 154.00
Timm8b sgRNA CRISPR Lentivector (Rat) (Target 2)
K7045703 1.0 ug DNA
EUR 154.00
Timm8b sgRNA CRISPR Lentivector (Rat) (Target 3)
K7045704 1.0 ug DNA
EUR 154.00
Timm8b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3928002 1.0 ug DNA
EUR 154.00
Timm8b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3928003 1.0 ug DNA
EUR 154.00
Timm8b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3928004 1.0 ug DNA
EUR 154.00
TIMM8B sgRNA CRISPR Lentivector (Human) (Target 1)
K2374802 1.0 ug DNA
EUR 154.00
TIMM8B sgRNA CRISPR Lentivector (Human) (Target 2)
K2374803 1.0 ug DNA
EUR 154.00
TIMM8B sgRNA CRISPR Lentivector (Human) (Target 3)
K2374804 1.0 ug DNA
EUR 154.00
TIMM8B Protein Vector (Rat) (pPB-C-His)
PV310886 500 ng
EUR 603.00
TIMM8B Protein Vector (Rat) (pPB-N-His)
PV310887 500 ng
EUR 603.00
TIMM8B Protein Vector (Rat) (pPM-C-HA)
PV310888 500 ng
EUR 603.00
TIMM8B Protein Vector (Rat) (pPM-C-His)
PV310889 500 ng
EUR 603.00
TIMM8B Protein Vector (Human) (pPB-C-His)
PV042125 500 ng
EUR 329.00
TIMM8B Protein Vector (Human) (pPB-N-His)
PV042126 500 ng
EUR 329.00
TIMM8B Protein Vector (Human) (pPM-C-HA)
PV042127 500 ng
EUR 329.00
TIMM8B Protein Vector (Human) (pPM-C-His)
PV042128 500 ng
EUR 329.00
TIMM8B Protein Vector (Mouse) (pPB-C-His)
PV238398 500 ng
EUR 603.00
TIMM8B Protein Vector (Mouse) (pPB-N-His)
PV238399 500 ng
EUR 603.00
TIMM8B Protein Vector (Mouse) (pPM-C-HA)
PV238400 500 ng
EUR 603.00
TIMM8B Protein Vector (Mouse) (pPM-C-His)
PV238401 500 ng
EUR 603.00
Timm8b 3'UTR Luciferase Stable Cell Line
TU120507 1.0 ml Ask for price
Timm8b 3'UTR GFP Stable Cell Line
TU170507 1.0 ml Ask for price
Timm8b 3'UTR Luciferase Stable Cell Line
TU221901 1.0 ml Ask for price
TIMM8B 3'UTR GFP Stable Cell Line
TU075590 1.0 ml
EUR 1394.00
Timm8b 3'UTR GFP Stable Cell Line
TU271901 1.0 ml Ask for price
TIMM8B 3'UTR Luciferase Stable Cell Line
TU025590 1.0 ml
EUR 1394.00
TIMM8B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV697645 1.0 ug DNA
EUR 514.00
TIMM8B Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV697649 1.0 ug DNA
EUR 514.00
TIMM8B Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV697650 1.0 ug DNA
EUR 514.00
Mitochondrial Import Inner Membrane Translocase Subunit Tim8 B (TIMM8B) Antibody
20-abx301770
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Timm8b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7045705 3 x 1.0 ug
EUR 376.00