TIMM9

TIMM9 siRNA
20-abx936816	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TIMM9 siRNA
20-abx936817	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TIMM9 antibody
70R-20833	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TIMM9 antibody

TIMM9 Antibody
1-CSB-PA897296LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TIMM9 Antibody
DF12487	Affbiotech	200ul	EUR 304
Description: TIMM9 antibody detects endogenous levels of TIMM9.

TIMM9 Antibody
1-CSB-PA023559GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti-TIMM9
YF-PA26003	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to TIMM9

anti- TIMM9 antibody
FNab08704	FN Test	100µg	EUR 548.75
Immunogen: translocase of inner mitochondrial membrane 9 homolog(yeast) Uniprot ID: Q9Y5J7 Gene ID: 26520 Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against TIMM9

TIMM9 Polyclonal Antibody
A61318	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

TIMM9 Rabbit pAb
A4627-100ul	Abclonal	100 ul	EUR 308

TIMM9 Rabbit pAb
A4627-200ul	Abclonal	200 ul	EUR 459

TIMM9 Rabbit pAb
A4627-20ul	Abclonal	20 ul	EUR 183

TIMM9 Rabbit pAb
A4627-50ul	Abclonal	50 ul	EUR 223

TIMM9 Polyclonal Antibody
30594-100ul	SAB	100ul	EUR 252

TIMM9 Polyclonal Antibody
30594-50ul	SAB	50ul	EUR 187

TIMM9 Blocking Peptide
DF12487-BP	Affbiotech	1mg	EUR 195

TIMM9 cloning plasmid
CSB-CL897296HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 270 Sequence: atggctgcacaaataccagaatctgatcagataaaacagtttaaggaatttctggggacctacaataaacttacagagacctgctttttggactgtgttaaagacttcacaacaagagaagtaaaacctgaagagaccacctgttcagaacattgcttacagaaatatttaaaaat Show more
Description: A cloning plasmid for the TIMM9 gene.

Anti-TIMM9 antibody
PAab08704	Lifescience Market	100 ug	EUR 386

Anti-TIMM9 antibody
STJ26765	St John's Laboratory	100 µl	EUR 277

Anti-TIMM9 (1D6)
YF-MA11441	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to TIMM9

TIMM9 Polyclonal Conjugated Antibody
C30594	SAB	100ul	EUR 397

Mouse TIMM9 shRNA Plasmid
20-abx974018	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat TIMM9 shRNA Plasmid
20-abx987709	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Chicken TIMM9 ELISA KIT
ELI-16252c	Lifescience Market	96 Tests	EUR 928

TIMM9 ELISA KIT|Human
EF003618	Lifescience Market	96 Tests	EUR 689

Human TIMM9 shRNA Plasmid
20-abx958845	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TIMM9 Antibody, HRP conjugated
1-CSB-PA897296LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TIMM9 Antibody, FITC conjugated
1-CSB-PA897296LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TIMM9 Antibody, Biotin conjugated
1-CSB-PA897296LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TIMM9 Recombinant Protein (Human)
RP031597	ABM	100 ug	Ask for price

TIMM9 Recombinant Protein (Mouse)
RP178799	ABM	100 ug	Ask for price

TIMM9 Recombinant Protein (Mouse)
RP178802	ABM	100 ug	Ask for price

TIMM9 Recombinant Protein (Mouse)
RP178805	ABM	100 ug	Ask for price

TIMM9 Polyclonal Antibody, Biotin Conjugated
A61319	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

TIMM9 Polyclonal Antibody, FITC Conjugated
A61320	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

TIMM9 Polyclonal Antibody, HRP Conjugated
A61321	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Timm9 ORF Vector (Mouse) (pORF)
ORF059601	ABM	1.0 ug DNA	EUR 506

Timm9 ORF Vector (Mouse) (pORF)
ORF059602	ABM	1.0 ug DNA	EUR 506

Timm9 ORF Vector (Mouse) (pORF)
ORF059603	ABM	1.0 ug DNA	EUR 506

TIMM9 ORF Vector (Human) (pORF)
ORF010533	ABM	1.0 ug DNA	EUR 95

TIMM9 ELISA Kit (Human) (OKEH08563)
OKEH08563	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: TIMM9 belongs to a family of evolutionarily conserved proteins that are organized in heterooligomeric complexes in the mitochondrial intermembrane space. These proteins mediate the import and insertion of hydrophobic membrane proteins into the mitochondrial inner membrane.[supplied by OMIM, Apr 2004];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 23.45pg/mL

TIMM9 sgRNA CRISPR Lentivector set (Human)
K2374901	ABM	3 x 1.0 ug	EUR 339

Timm9 sgRNA CRISPR Lentivector set (Mouse)
K4768701	ABM	3 x 1.0 ug	EUR 339

Monoclonal TIMM9 Antibody (monoclonal) (M01), Clone: 1D6
APR13737G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human TIMM9 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1D6. This antibody is applicable in WB and IHC, E

TIMM9 sgRNA CRISPR Lentivector (Human) (Target 1)
K2374902	ABM	1.0 ug DNA	EUR 154

TIMM9 sgRNA CRISPR Lentivector (Human) (Target 2)
K2374903	ABM	1.0 ug DNA	EUR 154

TIMM9 sgRNA CRISPR Lentivector (Human) (Target 3)
K2374904	ABM	1.0 ug DNA	EUR 154

Timm9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4768702	ABM	1.0 ug DNA	EUR 154

Timm9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4768703	ABM	1.0 ug DNA	EUR 154

Timm9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4768704	ABM	1.0 ug DNA	EUR 154

TIMM9 Protein Vector (Human) (pPB-C-His)
PV042129	ABM	500 ng	EUR 329

TIMM9 Protein Vector (Human) (pPB-N-His)
PV042130	ABM	500 ng	EUR 329

TIMM9 Protein Vector (Human) (pPM-C-HA)
PV042131	ABM	500 ng	EUR 329

TIMM9 Protein Vector (Human) (pPM-C-His)
PV042132	ABM	500 ng	EUR 329

TIMM9 Protein Vector (Mouse) (pPB-C-His)
PV238402	ABM	500 ng	EUR 603

TIMM9 Protein Vector (Mouse) (pPB-N-His)
PV238403	ABM	500 ng	EUR 603

TIMM9 Protein Vector (Mouse) (pPM-C-HA)
PV238404	ABM	500 ng	EUR 603

TIMM9 Protein Vector (Mouse) (pPM-C-His)
PV238405	ABM	500 ng	EUR 603

TIMM9 Protein Vector (Mouse) (pPB-C-His)
PV238406	ABM	500 ng	EUR 603

TIMM9 Protein Vector (Mouse) (pPB-N-His)
PV238407	ABM	500 ng	EUR 603

TIMM9 Protein Vector (Mouse) (pPM-C-HA)
PV238408	ABM	500 ng	EUR 603

TIMM9 Protein Vector (Mouse) (pPM-C-His)
PV238409	ABM	500 ng	EUR 603

TIMM9 Protein Vector (Mouse) (pPB-C-His)
PV238410	ABM	500 ng	EUR 603

TIMM9 Protein Vector (Mouse) (pPB-N-His)
PV238411	ABM	500 ng	EUR 603

TIMM9 Protein Vector (Mouse) (pPM-C-HA)
PV238412	ABM	500 ng	EUR 603

TIMM9 Protein Vector (Mouse) (pPM-C-His)
PV238413	ABM	500 ng	EUR 603

Timm9 3'UTR GFP Stable Cell Line
TU170508	ABM	1.0 ml	Ask for price

TIMM9 3'UTR GFP Stable Cell Line
TU075591	ABM	1.0 ml	EUR 1394

Timm9 3'UTR Luciferase Stable Cell Line
TU120508	ABM	1.0 ml	Ask for price

TIMM9 3'UTR Luciferase Stable Cell Line
TU025591	ABM	1.0 ml	EUR 1394

Timm9 3'UTR Luciferase Stable Cell Line
TU221902	ABM	1.0 ml	Ask for price

Timm9 3'UTR GFP Stable Cell Line
TU271902	ABM	1.0 ml	Ask for price

Mitochondrial Import Inner Membrane Translocase Subunit Tim9 (TIMM9) Antibody
20-abx116212	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Mitochondrial Import Inner Membrane Translocase Subunit Tim9 (TIMM9) Antibody
20-abx003480	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Mitochondrial Import Inner Membrane Translocase Subunit Tim9 (TIMM9) Antibody
abx238704-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.