In den Nachrichten


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TIMM9 antibody
70R-20833 50 ul
EUR 435.00
Description: Rabbit polyclonal TIMM9 antibody
TIMM9 Antibody
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
TIMM9 Antibody
DF12487 200ul
EUR 304.00
Description: TIMM9 antibody detects endogenous levels of TIMM9.
TIMM9 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
YF-PA26003 50 ul
EUR 334.00
Description: Mouse polyclonal to TIMM9
anti- TIMM9 antibody
FNab08704 100µg
EUR 548.75
  • Immunogen: translocase of inner mitochondrial membrane 9 homolog(yeast)
  • Uniprot ID: Q9Y5J7
  • Gene ID: 26520
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against TIMM9
TIMM9 Polyclonal Antibody
A61318 100 µg
EUR 570.55
Description: reagents widely cited
TIMM9 Rabbit pAb
A4627-100ul 100 ul
EUR 308.00
TIMM9 Rabbit pAb
A4627-200ul 200 ul
EUR 459.00
TIMM9 Rabbit pAb
A4627-20ul 20 ul
EUR 183.00
TIMM9 Rabbit pAb
A4627-50ul 50 ul
EUR 223.00
TIMM9 Polyclonal Antibody
30594-100ul 100ul
EUR 252.00
TIMM9 Polyclonal Antibody
30594-50ul 50ul
EUR 187.00
TIMM9 Blocking Peptide
DF12487-BP 1mg
EUR 195.00
TIMM9 cloning plasmid
CSB-CL897296HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 270
  • Sequence: atggctgcacaaataccagaatctgatcagataaaacagtttaaggaatttctggggacctacaataaacttacagagacctgctttttggactgtgttaaagacttcacaacaagagaagtaaaacctgaagagaccacctgttcagaacattgcttacagaaatatttaaaaat
  • Show more
Description: A cloning plasmid for the TIMM9 gene.
Anti-TIMM9 antibody
PAab08704 100 ug
EUR 386.00
Anti-TIMM9 antibody
STJ26765 100 µl
EUR 277.00
Anti-TIMM9 (1D6)
YF-MA11441 100 ug
EUR 363.00
Description: Mouse monoclonal to TIMM9
TIMM9 Polyclonal Conjugated Antibody
C30594 100ul
EUR 397.00
Mouse TIMM9 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Rat TIMM9 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
ELI-16252c 96 Tests
EUR 928.00
EF003618 96 Tests
EUR 689.00
Human TIMM9 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
TIMM9 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TIMM9 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TIMM9 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TIMM9 Recombinant Protein (Human)
RP031597 100 ug Ask for price
TIMM9 Recombinant Protein (Mouse)
RP178799 100 ug Ask for price
TIMM9 Recombinant Protein (Mouse)
RP178802 100 ug Ask for price
TIMM9 Recombinant Protein (Mouse)
RP178805 100 ug Ask for price
TIMM9 Polyclonal Antibody, Biotin Conjugated
A61319 100 µg
EUR 570.55
Description: Ask the seller for details
TIMM9 Polyclonal Antibody, FITC Conjugated
A61320 100 µg
EUR 570.55
Description: The best epigenetics products
TIMM9 Polyclonal Antibody, HRP Conjugated
A61321 100 µg
EUR 570.55
Description: kits suitable for this type of research
Timm9 ORF Vector (Mouse) (pORF)
ORF059601 1.0 ug DNA
EUR 506.00
Timm9 ORF Vector (Mouse) (pORF)
ORF059602 1.0 ug DNA
EUR 506.00
Timm9 ORF Vector (Mouse) (pORF)
ORF059603 1.0 ug DNA
EUR 506.00
TIMM9 ORF Vector (Human) (pORF)
ORF010533 1.0 ug DNA
EUR 95.00
TIMM9 ELISA Kit (Human) (OKEH08563)
OKEH08563 96 Wells
EUR 896.00
Description: Description of target: TIMM9 belongs to a family of evolutionarily conserved proteins that are organized in heterooligomeric complexes in the mitochondrial intermembrane space. These proteins mediate the import and insertion of hydrophobic membrane proteins into the mitochondrial inner membrane.[supplied by OMIM, Apr 2004];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 23.45pg/mL
TIMM9 sgRNA CRISPR Lentivector set (Human)
K2374901 3 x 1.0 ug
EUR 339.00
Timm9 sgRNA CRISPR Lentivector set (Mouse)
K4768701 3 x 1.0 ug
EUR 339.00
Monoclonal TIMM9 Antibody (monoclonal) (M01), Clone: 1D6
APR13737G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human TIMM9 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1D6. This antibody is applicable in WB and IHC, E
TIMM9 sgRNA CRISPR Lentivector (Human) (Target 1)
K2374902 1.0 ug DNA
EUR 154.00
TIMM9 sgRNA CRISPR Lentivector (Human) (Target 2)
K2374903 1.0 ug DNA
EUR 154.00
TIMM9 sgRNA CRISPR Lentivector (Human) (Target 3)
K2374904 1.0 ug DNA
EUR 154.00
Timm9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4768702 1.0 ug DNA
EUR 154.00
Timm9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4768703 1.0 ug DNA
EUR 154.00
Timm9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4768704 1.0 ug DNA
EUR 154.00
TIMM9 Protein Vector (Human) (pPB-C-His)
PV042129 500 ng
EUR 329.00
TIMM9 Protein Vector (Human) (pPB-N-His)
PV042130 500 ng
EUR 329.00
TIMM9 Protein Vector (Human) (pPM-C-HA)
PV042131 500 ng
EUR 329.00
TIMM9 Protein Vector (Human) (pPM-C-His)
PV042132 500 ng
EUR 329.00
TIMM9 Protein Vector (Mouse) (pPB-C-His)
PV238402 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPB-N-His)
PV238403 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPM-C-HA)
PV238404 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPM-C-His)
PV238405 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPB-C-His)
PV238406 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPB-N-His)
PV238407 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPM-C-HA)
PV238408 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPM-C-His)
PV238409 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPB-C-His)
PV238410 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPB-N-His)
PV238411 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPM-C-HA)
PV238412 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPM-C-His)
PV238413 500 ng
EUR 603.00
Timm9 3'UTR GFP Stable Cell Line
TU170508 1.0 ml Ask for price
TIMM9 3'UTR GFP Stable Cell Line
TU075591 1.0 ml
EUR 1394.00
Timm9 3'UTR Luciferase Stable Cell Line
TU120508 1.0 ml Ask for price
TIMM9 3'UTR Luciferase Stable Cell Line
TU025591 1.0 ml
EUR 1394.00
Timm9 3'UTR Luciferase Stable Cell Line
TU221902 1.0 ml Ask for price
Timm9 3'UTR GFP Stable Cell Line
TU271902 1.0 ml Ask for price
Mitochondrial Import Inner Membrane Translocase Subunit Tim9 (TIMM9) Antibody
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Mitochondrial Import Inner Membrane Translocase Subunit Tim9 (TIMM9) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
Mitochondrial Import Inner Membrane Translocase Subunit Tim9 (TIMM9) Antibody
abx238704-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.