In den Nachrichten


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TMED10 Protein
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TMED10 antibody
70R-20857 50 ul
EUR 435.00
Description: Rabbit polyclonal TMED10 antibody
TMED10 antibody
70R-7250 50 ug
EUR 467.00
Description: Rabbit polyclonal TMED10 antibody
TMED10 antibody
39167-100ul 100ul
EUR 252.00
TMED10 Antibody
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TMED10. Recognizes TMED10 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
TMED10 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TMED10. Recognizes TMED10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
TMED10 Conjugated Antibody
C39167 100ul
EUR 397.00
TMED10 cloning plasmid
CSB-CL023655HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 660
  • Sequence: atgtctggtttgtctggcccaccagcccggcgcggcccttttccgttagcgttgctgcttttgttcctgctcggccccagattggtccttgccatctccttccatctgcccattaactctcgcaagtgcctccgtgaggagattcacaaggacctgctagtgactggcgcgtacga
  • Show more
Description: A cloning plasmid for the TMED10 gene.
TMED10 Rabbit pAb
A6771-100ul 100 ul
EUR 308.00
TMED10 Rabbit pAb
A6771-200ul 200 ul
EUR 459.00
TMED10 Rabbit pAb
A6771-20ul 20 ul
EUR 183.00
TMED10 Rabbit pAb
A6771-50ul 50 ul
EUR 223.00
TMED10 Blocking Peptide
33R-4515 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMED10 antibody, catalog no. 70R-7250
Anti-TMED10 antibody
STJ28854 100 µl
EUR 277.00
Description: This gene is a member of the EMP24/GP25L/p24 family and encodes a protein with a GOLD domain. This type I membrane protein is localized to the plasma membrane and golgi cisternae and is involved in vesicular protein trafficking. The protein is also a member of a heteromeric secretase complex and regulates the complex's gamma-secretase activity without affecting its epsilon-secretase activity. Mutations in this gene have been associated with early-onset familial Alzheimer's disease. This gene has a pseudogene on chromosome 8.
Anti-TMED10 antibody
STJ11100063 100 µl
EUR 413.00
Description: This gene is a member of the EMP24/GP25L/p24 family and encodes a protein with a GOLD domain. This type I membrane protein is localized to the plasma membrane and golgi cisternae and is involved in vesicular protein trafficking. The protein is also a member of a heteromeric secretase complex and regulates the complex's gamma-secretase activity without affecting its epsilon-secretase activity. Mutations in this gene have been associated with early-onset familial Alzheimer's disease. This gene has a pseudogene on chromosome 8.
Mouse TMED10 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Rat TMED10 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse Tmed10 ELISA KIT
ELI-16306m 96 Tests
EUR 865.00
ELI-17369h 96 Tests
EUR 824.00
ELI-29081b 96 Tests
EUR 928.00
Human TMED10 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
TMED10 protein (His tag)
80R-2959 20 ug
EUR 327.00
Description: Purified recombinant CTSF protein (His tag)
TMED10 Recombinant Protein (Human)
RP031807 100 ug Ask for price
TMED10 Recombinant Protein (Rat)
RP233384 100 ug Ask for price
TMED10 Recombinant Protein (Mouse)
RP179144 100 ug Ask for price
Anti-TMP21 / TMED10 antibody
STJ71105 100 µg
EUR 359.00
Polyclonal TMED10 / TMP21 Antibody (Internal)
APR13741G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMED10 / TMP21 (Internal). This antibody is tested and proven to work in the following applications:
Polyclonal TMED10 Antibody (C-term)
APR13742G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMED10 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal TMED10 Antibody (C-term)
APR13743G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMED10 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal TMED10 Antibody (C-term)
APR13744G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMED10 (C-term). This antibody is tested and proven to work in the following applications:
[KO Validated] TMED10 Rabbit pAb
A18090-100ul 100 ul
EUR 410.00
[KO Validated] TMED10 Rabbit pAb
A18090-200ul 200 ul
EUR 571.00
[KO Validated] TMED10 Rabbit pAb
A18090-20ul 20 ul
EUR 221.00
[KO Validated] TMED10 Rabbit pAb
A18090-50ul 50 ul
EUR 287.00
Tmed10 ORF Vector (Mouse) (pORF)
ORF059716 1.0 ug DNA
EUR 506.00
TMED10 ORF Vector (Human) (pORF)
ORF010603 1.0 ug DNA
EUR 95.00
Tmed10 ORF Vector (Rat) (pORF)
ORF077796 1.0 ug DNA
EUR 506.00
Polyclonal TMED10 / TMP21 Antibody (C-Terminus)
APR13740G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMED10 / TMP21 (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal TMP21 / TMED10 Antibody (C-Term)
APR13759G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TMP21 / TMED10 (C-Term). This antibody is tested and proven to work in the following applications:
TMED10 sgRNA CRISPR Lentivector set (Human)
K2385901 3 x 1.0 ug
EUR 339.00
Tmed10 sgRNA CRISPR Lentivector set (Mouse)
K4884501 3 x 1.0 ug
EUR 339.00
Tmed10 sgRNA CRISPR Lentivector set (Rat)
K6949301 3 x 1.0 ug
EUR 339.00
TMED10 sgRNA CRISPR Lentivector (Human) (Target 1)
K2385902 1.0 ug DNA
EUR 154.00
TMED10 sgRNA CRISPR Lentivector (Human) (Target 2)
K2385903 1.0 ug DNA
EUR 154.00
TMED10 sgRNA CRISPR Lentivector (Human) (Target 3)
K2385904 1.0 ug DNA
EUR 154.00
Tmed10 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4884502 1.0 ug DNA
EUR 154.00
Tmed10 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4884503 1.0 ug DNA
EUR 154.00
Tmed10 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4884504 1.0 ug DNA
EUR 154.00
Tmed10 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6949302 1.0 ug DNA
EUR 154.00
Tmed10 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6949303 1.0 ug DNA
EUR 154.00
Tmed10 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6949304 1.0 ug DNA
EUR 154.00
TMED10 Protein Vector (Human) (pPB-C-His)
PV042409 500 ng
EUR 329.00
TMED10 Protein Vector (Human) (pPB-N-His)
PV042410 500 ng
EUR 329.00
TMED10 Protein Vector (Human) (pPM-C-HA)
PV042411 500 ng
EUR 329.00
TMED10 Protein Vector (Human) (pPM-C-His)
PV042412 500 ng
EUR 329.00
Recombinant Human TMED10 Protein, His, E.coli-100ug
QP13761-100ug 100ug
EUR 1261.00
Recombinant Human TMED10 Protein, His, E.coli-10ug
QP13761-10ug 10ug
EUR 201.00
Recombinant Human TMED10 Protein, His, E.coli-2ug
QP13761-2ug 2ug
EUR 155.00
TMED10 Protein Vector (Rat) (pPB-C-His)
PV311182 500 ng
EUR 603.00
TMED10 Protein Vector (Rat) (pPB-N-His)
PV311183 500 ng
EUR 603.00
TMED10 Protein Vector (Rat) (pPM-C-HA)
PV311184 500 ng
EUR 603.00
TMED10 Protein Vector (Rat) (pPM-C-His)
PV311185 500 ng
EUR 603.00
TMED10 Protein Vector (Mouse) (pPB-C-His)
PV238862 500 ng
EUR 603.00
TMED10 Protein Vector (Mouse) (pPB-N-His)
PV238863 500 ng
EUR 603.00
TMED10 Protein Vector (Mouse) (pPM-C-HA)
PV238864 500 ng
EUR 603.00
TMED10 Protein Vector (Mouse) (pPM-C-His)
PV238865 500 ng
EUR 603.00
Tmed10 3'UTR GFP Stable Cell Line
TU170597 1.0 ml Ask for price
TMED10 3'UTR GFP Stable Cell Line
TU075705 1.0 ml
EUR 2333.00
Tmed10 3'UTR Luciferase Stable Cell Line
TU120597 1.0 ml Ask for price
TMED10 3'UTR Luciferase Stable Cell Line
TU025705 1.0 ml
EUR 2333.00
Tmed10 3'UTR Luciferase Stable Cell Line
TU221984 1.0 ml Ask for price
Tmed10 3'UTR GFP Stable Cell Line
TU271984 1.0 ml Ask for price