TMED10

TMED10 siRNA
20-abx905607	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMED10 Protein
20-abx263233	Abbexa	EUR 1609.00 EUR 328.00 EUR 230.00	0.1 mg 10 ug 2 µg
Shipped within 5-10 working days.

TMED10 siRNA
20-abx936988	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMED10 siRNA
20-abx936989	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMED10 antibody
70R-20857	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TMED10 antibody

TMED10 antibody
70R-7250	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal TMED10 antibody

TMED10 antibody
39167-100ul	SAB	100ul	EUR 252

TMED10 Antibody
1-CSB-PA023655ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TMED10. Recognizes TMED10 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

TMED10 Antibody
1-CSB-PA023655GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TMED10. Recognizes TMED10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

TMED10 Conjugated Antibody
C39167	SAB	100ul	EUR 397

TMED10 cloning plasmid
CSB-CL023655HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 660 Sequence: atgtctggtttgtctggcccaccagcccggcgcggcccttttccgttagcgttgctgcttttgttcctgctcggccccagattggtccttgccatctccttccatctgcccattaactctcgcaagtgcctccgtgaggagattcacaaggacctgctagtgactggcgcgtacga Show more
Description: A cloning plasmid for the TMED10 gene.

TMED10 Rabbit pAb
A6771-100ul	Abclonal	100 ul	EUR 308

TMED10 Rabbit pAb
A6771-200ul	Abclonal	200 ul	EUR 459

TMED10 Rabbit pAb
A6771-20ul	Abclonal	20 ul	EUR 183

TMED10 Rabbit pAb
A6771-50ul	Abclonal	50 ul	EUR 223

TMED10 Blocking Peptide
33R-4515	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMED10 antibody, catalog no. 70R-7250

Anti-TMED10 antibody
STJ28854	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the EMP24/GP25L/p24 family and encodes a protein with a GOLD domain. This type I membrane protein is localized to the plasma membrane and golgi cisternae and is involved in vesicular protein trafficking. The protein is also a member of a heteromeric secretase complex and regulates the complex's gamma-secretase activity without affecting its epsilon-secretase activity. Mutations in this gene have been associated with early-onset familial Alzheimer's disease. This gene has a pseudogene on chromosome 8.

Anti-TMED10 antibody
STJ11100063	St John's Laboratory	100 µl	EUR 413
Description: This gene is a member of the EMP24/GP25L/p24 family and encodes a protein with a GOLD domain. This type I membrane protein is localized to the plasma membrane and golgi cisternae and is involved in vesicular protein trafficking. The protein is also a member of a heteromeric secretase complex and regulates the complex's gamma-secretase activity without affecting its epsilon-secretase activity. Mutations in this gene have been associated with early-onset familial Alzheimer's disease. This gene has a pseudogene on chromosome 8.

Mouse TMED10 shRNA Plasmid
20-abx976668	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat TMED10 shRNA Plasmid
20-abx986981	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Tmed10 ELISA KIT
ELI-16306m	Lifescience Market	96 Tests	EUR 865

Human TMED10 ELISA KIT
ELI-17369h	Lifescience Market	96 Tests	EUR 824

Bovine TMED10 ELISA KIT
ELI-29081b	Lifescience Market	96 Tests	EUR 928

Human TMED10 shRNA Plasmid
20-abx957491	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TMED10 protein (His tag)
80R-2959	Fitzgerald	20 ug	EUR 327
Description: Purified recombinant CTSF protein (His tag)

TMED10 Recombinant Protein (Human)
RP031807	ABM	100 ug	Ask for price

TMED10 Recombinant Protein (Rat)
RP233384	ABM	100 ug	Ask for price

TMED10 Recombinant Protein (Mouse)
RP179144	ABM	100 ug	Ask for price

Anti-TMP21 / TMED10 antibody
STJ71105	St John's Laboratory	100 µg	EUR 359

Polyclonal TMED10 / TMP21 Antibody (Internal)
APR13741G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMED10 / TMP21 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal TMED10 Antibody (C-term)
APR13742G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMED10 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TMED10 Antibody (C-term)
APR13743G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMED10 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TMED10 Antibody (C-term)
APR13744G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMED10 (C-term). This antibody is tested and proven to work in the following applications:

[KO Validated] TMED10 Rabbit pAb
A18090-100ul	Abclonal	100 ul	EUR 410

[KO Validated] TMED10 Rabbit pAb
A18090-200ul	Abclonal	200 ul	EUR 571

[KO Validated] TMED10 Rabbit pAb
A18090-20ul	Abclonal	20 ul	EUR 221

[KO Validated] TMED10 Rabbit pAb
A18090-50ul	Abclonal	50 ul	EUR 287

Tmed10 ORF Vector (Mouse) (pORF)
ORF059716	ABM	1.0 ug DNA	EUR 506

TMED10 ORF Vector (Human) (pORF)
ORF010603	ABM	1.0 ug DNA	EUR 95

Tmed10 ORF Vector (Rat) (pORF)
ORF077796	ABM	1.0 ug DNA	EUR 506

Polyclonal TMED10 / TMP21 Antibody (C-Terminus)
APR13740G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMED10 / TMP21 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal TMP21 / TMED10 Antibody (C-Term)
APR13759G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TMP21 / TMED10 (C-Term). This antibody is tested and proven to work in the following applications:

TMED10 sgRNA CRISPR Lentivector set (Human)
K2385901	ABM	3 x 1.0 ug	EUR 339

Tmed10 sgRNA CRISPR Lentivector set (Mouse)
K4884501	ABM	3 x 1.0 ug	EUR 339

Tmed10 sgRNA CRISPR Lentivector set (Rat)
K6949301	ABM	3 x 1.0 ug	EUR 339

TMED10 sgRNA CRISPR Lentivector (Human) (Target 1)
K2385902	ABM	1.0 ug DNA	EUR 154

TMED10 sgRNA CRISPR Lentivector (Human) (Target 2)
K2385903	ABM	1.0 ug DNA	EUR 154

TMED10 sgRNA CRISPR Lentivector (Human) (Target 3)
K2385904	ABM	1.0 ug DNA	EUR 154

Tmed10 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4884502	ABM	1.0 ug DNA	EUR 154

Tmed10 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4884503	ABM	1.0 ug DNA	EUR 154

Tmed10 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4884504	ABM	1.0 ug DNA	EUR 154

Tmed10 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6949302	ABM	1.0 ug DNA	EUR 154

Tmed10 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6949303	ABM	1.0 ug DNA	EUR 154

Tmed10 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6949304	ABM	1.0 ug DNA	EUR 154

TMED10 Protein Vector (Human) (pPB-C-His)
PV042409	ABM	500 ng	EUR 329

TMED10 Protein Vector (Human) (pPB-N-His)
PV042410	ABM	500 ng	EUR 329

TMED10 Protein Vector (Human) (pPM-C-HA)
PV042411	ABM	500 ng	EUR 329

TMED10 Protein Vector (Human) (pPM-C-His)
PV042412	ABM	500 ng	EUR 329

Recombinant Human TMED10 Protein, His, E.coli-100ug
QP13761-100ug	EnQuireBio	100ug	EUR 1261

Recombinant Human TMED10 Protein, His, E.coli-10ug
QP13761-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human TMED10 Protein, His, E.coli-2ug
QP13761-2ug	EnQuireBio	2ug	EUR 155

TMED10 Protein Vector (Rat) (pPB-C-His)
PV311182	ABM	500 ng	EUR 603

TMED10 Protein Vector (Rat) (pPB-N-His)
PV311183	ABM	500 ng	EUR 603

TMED10 Protein Vector (Rat) (pPM-C-HA)
PV311184	ABM	500 ng	EUR 603

TMED10 Protein Vector (Rat) (pPM-C-His)
PV311185	ABM	500 ng	EUR 603

TMED10 Protein Vector (Mouse) (pPB-C-His)
PV238862	ABM	500 ng	EUR 603

TMED10 Protein Vector (Mouse) (pPB-N-His)
PV238863	ABM	500 ng	EUR 603

TMED10 Protein Vector (Mouse) (pPM-C-HA)
PV238864	ABM	500 ng	EUR 603

TMED10 Protein Vector (Mouse) (pPM-C-His)
PV238865	ABM	500 ng	EUR 603

Tmed10 3'UTR GFP Stable Cell Line
TU170597	ABM	1.0 ml	Ask for price

TMED10 3'UTR GFP Stable Cell Line
TU075705	ABM	1.0 ml	EUR 2333

Tmed10 3'UTR Luciferase Stable Cell Line
TU120597	ABM	1.0 ml	Ask for price

TMED10 3'UTR Luciferase Stable Cell Line
TU025705	ABM	1.0 ml	EUR 2333

Tmed10 3'UTR Luciferase Stable Cell Line
TU221984	ABM	1.0 ml	Ask for price

Tmed10 3'UTR GFP Stable Cell Line
TU271984	ABM	1.0 ml	Ask for price