TRAPPC4

TRAPPC4 antibody
70R-20967 50 ul
EUR 435.00
Description: Rabbit polyclonal TRAPPC4 antibody
TRAPPC4 Antibody
42979-100ul 100ul
EUR 252.00
TRAPPC4 antibody
70R-5260 50 ug
EUR 467.00
Description: Rabbit polyclonal TRAPPC4 antibody raised against the middle region of TRAPPC4
TRAPPC4 Antibody
1-CSB-PA024230GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRAPPC4. Recognizes TRAPPC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
TRAPPC4 siRNA
20-abx905772
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TRAPPC4 siRNA
20-abx937957
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TRAPPC4 siRNA
20-abx937958
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
pENTR223- TRAPPC4
PVT11466 2 ug
EUR 273.00
anti-TRAPPC4
YF-PA19029 50 ul
EUR 363.00
Description: Mouse polyclonal to TRAPPC4
TRAPPC4 Blocking Peptide
33R-2512 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAPPC4 antibody, catalog no. 70R-5260
TRAPPC4 cloning plasmid
CSB-CL897085HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 660
  • Sequence: atggcgatttttagtgtgtatgtggtgaacaaagctggcggcttgatttaccagttggacagctacgcgccacgggctgaggctgagaaaactttcagttatccgctggatctgctgctcaagctacacgatgagcgtgtgttggttgctttcggccagcgggacggcatccgagt
  • Show more
Description: A cloning plasmid for the TRAPPC4 gene.
TRAPPC4 Conjugated Antibody
C42979 100ul
EUR 397.00
anti- TRAPPC4 antibody
FNab08948 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: trafficking protein particle complex 4
  • Uniprot ID: Q9Y296
  • Gene ID: 51399
  • Research Area: Neuroscience
Description: Antibody raised against TRAPPC4
Anti-TRAPPC4 antibody
PAab08948 100 ug
EUR 386.00
Anti-TRAPPC4 (2D10)
YF-MA11509 100 ug
EUR 363.00
Description: Mouse monoclonal to TRAPPC4
Anti-TRAPPC4 (2D5)
YF-MA18497 100 ug
EUR 363.00
Description: Mouse monoclonal to TRAPPC4
TRAPPC4 protein (His tag)
80R-2572 20 ug
EUR 322.00
Description: Purified recombinant TRAPPC4 protein
TRAPPC4 ELISA KIT|Human
EF003801 96 Tests
EUR 689.00
Rat TRAPPC4 shRNA Plasmid
20-abx990680
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse TRAPPC4 shRNA Plasmid
20-abx975205
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human TRAPPC4 shRNA Plasmid
20-abx959747
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse Trappc4 ELISA KIT
ELI-39922m 96 Tests
EUR 865.00
Bovine TRAPPC4 ELISA KIT
ELI-40154b 96 Tests
EUR 928.00
Human TRAPPC4 ELISA KIT
ELI-36676h 96 Tests
EUR 824.00
TRAPPC4 Recombinant Protein (Rat)
RP234557 100 ug Ask for price
TRAPPC4 Recombinant Protein (Human)
RP032809 100 ug Ask for price
TRAPPC4 Recombinant Protein (Mouse)
RP180917 100 ug Ask for price
Polyclonal TRAPPC4 Antibody (N-term)
AMM08314G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAPPC4 (N-term). This antibody is tested and proven to work in the following applications:
Trappc4 ORF Vector (Rat) (pORF)
ORF078187 1.0 ug DNA
EUR 506.00
TRAPPC4 ORF Vector (Human) (pORF)
ORF010937 1.0 ug DNA
EUR 95.00
Trappc4 ORF Vector (Mouse) (pORF)
ORF060307 1.0 ug DNA
EUR 506.00
Trappc4 sgRNA CRISPR Lentivector set (Mouse)
K5004501 3 x 1.0 ug
EUR 339.00
Trappc4 sgRNA CRISPR Lentivector set (Rat)
K7335901 3 x 1.0 ug
EUR 339.00
TRAPPC4 sgRNA CRISPR Lentivector set (Human)
K2441601 3 x 1.0 ug
EUR 339.00
Monoclonal TRAPPC4 Antibody (monoclonal) (M01), Clone: 2D10
AMM08313G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human TRAPPC4 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 2D10. This antibody is applicable in WB and IF, E
Trafficking Protein Particle Complex 4 (TRAPPC4) Antibody
20-abx116142
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Trappc4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5004502 1.0 ug DNA
EUR 154.00
Trappc4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5004503 1.0 ug DNA
EUR 154.00
Trappc4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5004504 1.0 ug DNA
EUR 154.00
Trappc4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7335902 1.0 ug DNA
EUR 154.00
Trappc4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7335903 1.0 ug DNA
EUR 154.00
Trappc4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7335904 1.0 ug DNA
EUR 154.00
TRAPPC4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2441602 1.0 ug DNA
EUR 154.00
TRAPPC4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2441603 1.0 ug DNA
EUR 154.00
TRAPPC4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2441604 1.0 ug DNA
EUR 154.00
TRAPPC4 Protein Vector (Rat) (pPB-C-His)
PV312746 500 ng
EUR 603.00
TRAPPC4 Protein Vector (Rat) (pPB-N-His)
PV312747 500 ng
EUR 603.00
TRAPPC4 Protein Vector (Rat) (pPM-C-HA)
PV312748 500 ng
EUR 603.00
TRAPPC4 Protein Vector (Rat) (pPM-C-His)
PV312749 500 ng
EUR 603.00
TRAPPC4 Protein Vector (Mouse) (pPB-C-His)
PV241226 500 ng
EUR 603.00
TRAPPC4 Protein Vector (Mouse) (pPB-N-His)
PV241227 500 ng
EUR 603.00
TRAPPC4 Protein Vector (Mouse) (pPM-C-HA)
PV241228 500 ng
EUR 603.00
TRAPPC4 Protein Vector (Mouse) (pPM-C-His)
PV241229 500 ng
EUR 603.00
TRAPPC4 Protein Vector (Human) (pPB-C-His)
PV043745 500 ng
EUR 329.00
TRAPPC4 Protein Vector (Human) (pPB-N-His)
PV043746 500 ng
EUR 329.00
TRAPPC4 Protein Vector (Human) (pPM-C-HA)
PV043747 500 ng
EUR 329.00
TRAPPC4 Protein Vector (Human) (pPM-C-His)
PV043748 500 ng
EUR 329.00
Recombinant Human TRAPPC4 Protein, His, E.coli-100ug
QP13806-100ug 100ug
EUR 1261.00
Recombinant Human TRAPPC4 Protein, His, E.coli-10ug
QP13806-10ug 10ug
EUR 201.00
Recombinant Human TRAPPC4 Protein, His, E.coli-2ug
QP13806-2ug 2ug
EUR 155.00
Trappc4 3'UTR Luciferase Stable Cell Line
TU121042 1.0 ml Ask for price
Trappc4 3'UTR GFP Stable Cell Line
TU171042 1.0 ml Ask for price
Trappc4 3'UTR Luciferase Stable Cell Line
TU222394 1.0 ml Ask for price
TRAPPC4 3'UTR GFP Stable Cell Line
TU076300 1.0 ml
EUR 1394.00
TRAPPC4 3'UTR Luciferase Stable Cell Line
TU026300 1.0 ml
EUR 1394.00
Trappc4 3'UTR GFP Stable Cell Line
TU272394 1.0 ml Ask for price
Trafficking Protein Particle Complex Subunit 4 (TRAPPC4) Antibody
abx028156-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
Trafficking Protein Particle Complex Subunit 4 (TRAPPC4) Antibody
abx028156-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
Trafficking Protein Particle Complex Subunit 4 (TRAPPC4) Antibody
abx238948-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
TRAPPC4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV693211 1.0 ug DNA
EUR 514.00
TRAPPC4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV693215 1.0 ug DNA
EUR 514.00
TRAPPC4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV693216 1.0 ug DNA
EUR 514.00
TRAPPC4 Trafficking Protein Particle Complex 4 Human Recombinant Protein
PROTQ9Y296 Regular: 10ug
EUR 317.00
Description: TRAPPC4 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 242 amino acids (1-219) and having a molecular mass of 26.7kDa. ;TRAPPC4 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Human Trafficking Protein Particle Complex Subunit 4 (TRAPPC4) ELISA Kit
abx383909-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.
Trappc4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K5004505 3 x 1.0 ug
EUR 376.00