TRAPPC4 siRNA
20-abx905772	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

TRAPPC4 siRNA
20-abx937957	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

TRAPPC4 siRNA
20-abx937958	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

TRAPPC4 antibody
70R-5260	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal TRAPPC4 antibody raised against the middle region of TRAPPC4

TRAPPC4 antibody
70R-20967	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal TRAPPC4 antibody

TRAPPC4 Antibody
42979-100ul	SAB	100ul	EUR 252.00

TRAPPC4 Antibody
1-CSB-PA024230GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRAPPC4. Recognizes TRAPPC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

pENTR223- TRAPPC4
PVT11466	Lifescience Market	2 ug	EUR 273.00

anti-TRAPPC4
YF-PA19029	Abfrontier	50 ul	EUR 363.00
Description: Mouse polyclonal to TRAPPC4

TRAPPC4 Conjugated Antibody
C42979	SAB	100ul	EUR 397.00

anti- TRAPPC4 antibody
FNab08948	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:2000 Immunogen: trafficking protein particle complex 4 Uniprot ID: Q9Y296 Gene ID: 51399 Research Area: Neuroscience
Description: Antibody raised against TRAPPC4

TRAPPC4 Blocking Peptide
33R-2512	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAPPC4 antibody, catalog no. 70R-5260

TRAPPC4 cloning plasmid
CSB-CL897085HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 660 Sequence: atggcgatttttagtgtgtatgtggtgaacaaagctggcggcttgatttaccagttggacagctacgcgccacgggctgaggctgagaaaactttcagttatccgctggatctgctgctcaagctacacgatgagcgtgtgttggttgctttcggccagcgggacggcatccgagt Show more
Description: A cloning plasmid for the TRAPPC4 gene.

Anti-TRAPPC4 antibody
PAab08948	Lifescience Market	100 ug	EUR 386.00

Anti-TRAPPC4 (2D5)
YF-MA18497	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to TRAPPC4

Anti-TRAPPC4 (2D10)
YF-MA11509	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to TRAPPC4

Mouse TRAPPC4 shRNA Plasmid
20-abx975205	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

TRAPPC4 ELISA KIT|Human
EF003801	Lifescience Market	96 Tests	EUR 689.00

Human TRAPPC4 ELISA KIT
ELI-36676h	Lifescience Market	96 Tests	EUR 824.00

Mouse Trappc4 ELISA KIT
ELI-39922m	Lifescience Market	96 Tests	EUR 865.00

Bovine TRAPPC4 ELISA KIT
ELI-40154b	Lifescience Market	96 Tests	EUR 928.00

Human TRAPPC4 shRNA Plasmid
20-abx959747	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

TRAPPC4 protein (His tag)
80R-2572	Fitzgerald	20 ug	EUR 322.00
Description: Purified recombinant TRAPPC4 protein

Rat TRAPPC4 shRNA Plasmid
20-abx990680	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

TRAPPC4 Recombinant Protein (Human)
RP032809	ABM	100 ug	Ask for price

TRAPPC4 Recombinant Protein (Rat)
RP234557	ABM	100 ug	Ask for price

TRAPPC4 Recombinant Protein (Mouse)
RP180917	ABM	100 ug	Ask for price

Polyclonal TRAPPC4 Antibody (N-term)
AMM08314G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAPPC4 (N-term). This antibody is tested and proven to work in the following applications:

Trappc4 ORF Vector (Rat) (pORF)
ORF078187	ABM	1.0 ug DNA	EUR 506.00

TRAPPC4 ORF Vector (Human) (pORF)
ORF010937	ABM	1.0 ug DNA	EUR 95.00

Trappc4 ORF Vector (Mouse) (pORF)
ORF060307	ABM	1.0 ug DNA	EUR 506.00

TRAPPC4 sgRNA CRISPR Lentivector set (Human)
K2441601	ABM	3 x 1.0 ug	EUR 339.00

Trappc4 sgRNA CRISPR Lentivector set (Mouse)
K5004501	ABM	3 x 1.0 ug	EUR 339.00

Trappc4 sgRNA CRISPR Lentivector set (Rat)
K7335901	ABM	3 x 1.0 ug	EUR 339.00

Monoclonal TRAPPC4 Antibody (monoclonal) (M01), Clone: 2D10
AMM08313G	Leading Biology	0.1mg	EUR 484.00
Description: A Monoclonal antibody against Human TRAPPC4 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 2D10. This antibody is applicable in WB and IF, E

Trafficking Protein Particle Complex 4 (TRAPPC4) Antibody
20-abx116142	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

TRAPPC4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2441602	ABM	1.0 ug DNA	EUR 154.00

TRAPPC4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2441603	ABM	1.0 ug DNA	EUR 154.00

TRAPPC4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2441604	ABM	1.0 ug DNA	EUR 154.00

Trappc4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5004502	ABM	1.0 ug DNA	EUR 154.00

Trappc4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5004503	ABM	1.0 ug DNA	EUR 154.00

Trappc4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5004504	ABM	1.0 ug DNA	EUR 154.00

Trappc4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7335902	ABM	1.0 ug DNA	EUR 154.00

Trappc4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7335903	ABM	1.0 ug DNA	EUR 154.00

Trappc4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7335904	ABM	1.0 ug DNA	EUR 154.00

TRAPPC4 Protein Vector (Human) (pPB-C-His)
PV043745	ABM	500 ng	EUR 329.00

TRAPPC4 Protein Vector (Human) (pPB-N-His)
PV043746	ABM	500 ng	EUR 329.00

TRAPPC4 Protein Vector (Human) (pPM-C-HA)
PV043747	ABM	500 ng	EUR 329.00

TRAPPC4 Protein Vector (Human) (pPM-C-His)
PV043748	ABM	500 ng	EUR 329.00

Recombinant Human TRAPPC4 Protein, His, E.coli-100ug
QP13806-100ug	EnQuireBio	100ug	EUR 1261.00

Recombinant Human TRAPPC4 Protein, His, E.coli-10ug
QP13806-10ug	EnQuireBio	10ug	EUR 201.00

Recombinant Human TRAPPC4 Protein, His, E.coli-2ug
QP13806-2ug	EnQuireBio	2ug	EUR 155.00

TRAPPC4 Protein Vector (Rat) (pPB-C-His)
PV312746	ABM	500 ng	EUR 603.00

TRAPPC4 Protein Vector (Rat) (pPB-N-His)
PV312747	ABM	500 ng	EUR 603.00

TRAPPC4 Protein Vector (Rat) (pPM-C-HA)
PV312748	ABM	500 ng	EUR 603.00

TRAPPC4 Protein Vector (Rat) (pPM-C-His)
PV312749	ABM	500 ng	EUR 603.00

TRAPPC4 Protein Vector (Mouse) (pPB-C-His)
PV241226	ABM	500 ng	EUR 603.00

TRAPPC4 Protein Vector (Mouse) (pPB-N-His)
PV241227	ABM	500 ng	EUR 603.00

TRAPPC4 Protein Vector (Mouse) (pPM-C-HA)
PV241228	ABM	500 ng	EUR 603.00

TRAPPC4 Protein Vector (Mouse) (pPM-C-His)
PV241229	ABM	500 ng	EUR 603.00

Trappc4 3'UTR GFP Stable Cell Line
TU171042	ABM	1.0 ml	Ask for price

TRAPPC4 3'UTR GFP Stable Cell Line
TU076300	ABM	1.0 ml	EUR 1394.00

Trappc4 3'UTR Luciferase Stable Cell Line
TU121042	ABM	1.0 ml	Ask for price

TRAPPC4 3'UTR Luciferase Stable Cell Line
TU026300	ABM	1.0 ml	EUR 1394.00

Trappc4 3'UTR Luciferase Stable Cell Line
TU222394	ABM	1.0 ml	Ask for price

Trappc4 3'UTR GFP Stable Cell Line
TU272394	ABM	1.0 ml	Ask for price

Trafficking Protein Particle Complex Subunit 4 (TRAPPC4) Antibody
abx028156-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Trafficking Protein Particle Complex Subunit 4 (TRAPPC4) Antibody
abx028156-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Trafficking Protein Particle Complex Subunit 4 (TRAPPC4) Antibody
abx238948-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

TRAPPC4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV693211	ABM	1.0 ug DNA	EUR 514.00

TRAPPC4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV693215	ABM	1.0 ug DNA	EUR 514.00

TRAPPC4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV693216	ABM	1.0 ug DNA	EUR 514.00

TRAPPC4 Trafficking Protein Particle Complex 4 Human Recombinant Protein
PROTQ9Y296	BosterBio	Regular: 10ug	EUR 317.00
Description: TRAPPC4 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 242 amino acids (1-219) and having a molecular mass of 26.7kDa. ;TRAPPC4 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Trafficking Protein Particle Complex Subunit 4 (TRAPPC4) ELISA Kit
abx383909-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

TRAPPC4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2441605	ABM	3 x 1.0 ug	EUR 376.00