TSTA3

TSTA3 siRNA
20-abx938400	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

TSTA3 antibody
70R-35685	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal TSTA3 antibody

TSTA3 antibody
70R-21043	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal TSTA3 antibody

TSTA3 antibody
70R-6048	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal TSTA3 antibody raised against the N terminal of TSTA3

TSTA3 Antibody
ABD4085	Lifescience Market	100 ug	EUR 438.00

TSTA3 Antibody
34703-100ul	SAB	100ul	EUR 252.00

TSTA3 Antibody
34703-50ul	SAB	50ul	EUR 187.00

TSTA3 antibody
70R-15347	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal TSTA3 antibody

TSTA3 Antibody
DF4085	Affbiotech	200ul	EUR 304.00
Description: TSTA3 Antibody detects endogenous levels of total TSTA3.

TSTA3 Antibody
CSB-PA790986-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TSTA3 Antibody
CSB-PA790986-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

TSTA3 Antibody
1-CSB-PA00935A0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

TSTA3 Antibody
1-CSB-PA060020	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

TSTA3 Antibody
1-CSB-PA025200GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-TSTA3
YF-PA15142	Abfrontier	50 ul	EUR 363.00
Description: Mouse polyclonal to TSTA3

anti-TSTA3
YF-PA15143	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to TSTA3

anti-TSTA3
YF-PA15144	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to TSTA3

anti-TSTA3
YF-PA24908	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to TSTA3

Polyclonal TSTA3 Antibody
APR10597G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSTA3 . This antibody is tested and proven to work in the following applications:

TSTA3 Conjugated Antibody
C34703	SAB	100ul	EUR 397.00

anti- TSTA3 antibody
FNab09075	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 Immunogen: tissue specific transplantation antigen P35B Uniprot ID: Q13630 Gene ID: 7264 Research Area: Metabolism
Description: Antibody raised against TSTA3

Mouse Tsta3 Antibody
abx030949-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Mouse Tsta3 Antibody
abx030949-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

TSTA3 Rabbit pAb
A4169-100ul	Abclonal	100 ul	EUR 308.00

TSTA3 Rabbit pAb
A4169-200ul	Abclonal	200 ul	EUR 459.00

TSTA3 Rabbit pAb
A4169-20ul	Abclonal	20 ul	EUR 183.00

TSTA3 Rabbit pAb
A4169-50ul	Abclonal	50 ul	EUR 223.00

TSTA3 Polyclonal Antibody
A53877	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

TSTA3 Blocking Peptide
33R-6023	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSTA3 antibody, catalog no. 70R-6048

TSTA3 antibody (HRP)
60R-1858	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal TSTA3 antibody (HRP)

TSTA3 antibody (FITC)
60R-1859	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal TSTA3 antibody (FITC)

TSTA3 antibody (biotin)
60R-1860	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal TSTA3 antibody (biotin)

TSTA3 Blocking Peptide
DF4085-BP	Affbiotech	1mg	EUR 195.00

TSTA3 cloning plasmid
CSB-CL619783HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 966 Sequence: atgggtgaaccccagggatccatgcggattctagtgacagggggctctgggctggtaggcaaagccatccagaaggtggtagcagatggagctggacttcctggagaggactgggtgtttgtctcctctaaagacgccgatctcacggatacagcacagacccgcgccctgtttga Show more
Description: A cloning plasmid for the TSTA3 gene.

Anti-TSTA3 antibody
PAab09075	Lifescience Market	100 ug	EUR 386.00

Anti-TSTA3 antibody
STJ26557	St John's Laboratory	100 µl	EUR 277.00
Description: Tissue specific transplantation antigen P35B is a NADP(H)-binding protein. It catalyze the two-step epimerase and the reductase reactions in GDP-D-mannose metabolism, converting GDP-4-keto-6-D-deoxymannose to GDP-L-fucose. GDP-L-fucose is the substrate of several fucosyltransferases involved in the expression of many glycoconjugates, including blood group ABH antigens and developmental adhesion antigens. Mutations in this gene may cause leukocyte adhesion deficiency, type II.

Anti-TSTA3 (2B9)
YF-MA15950	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to TSTA3

TSTA3 ELISA KIT|Human
EF003915	Lifescience Market	96 Tests	EUR 689.00

Human TSTA3 shRNA Plasmid
20-abx954964	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

TSTA3 protein (His tag)
80R-1419	Fitzgerald	100 ug	EUR 305.00
Description: Purified recombinant Human TSTA3 protein

Mouse TSTA3 shRNA Plasmid
20-abx973244	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

TSTA3 Antibody, HRP conjugated
1-CSB-PA00935B0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TSTA3 Antibody, FITC conjugated
1-CSB-PA00935C0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TSTA3 Antibody, Biotin conjugated
1-CSB-PA00935D0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TSTA3 Recombinant Protein (Human)
RP033253	ABM	100 ug	Ask for price

TSTA3 Recombinant Protein (Rat)
RP235088	ABM	100 ug	Ask for price

TSTA3 Recombinant Protein (Mouse)
RP181907	ABM	100 ug	Ask for price

TSTA3 Polyclonal Antibody, HRP Conjugated
A53878	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

TSTA3 Polyclonal Antibody, FITC Conjugated
A53879	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

TSTA3 Polyclonal Antibody, Biotin Conjugated
A53880	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Tsta3 ORF Vector (Rat) (pORF)
ORF078364	ABM	1.0 ug DNA	EUR 506.00

TSTA3 ORF Vector (Human) (pORF)
ORF011085	ABM	1.0 ug DNA	EUR 95.00

Tsta3 ORF Vector (Mouse) (pORF)
ORF060637	ABM	1.0 ug DNA	EUR 506.00

TSTA3 ELISA Kit (Human) (OKEH03537)
OKEH03537	Aviva Systems Biology	96 Wells	EUR 779.00
Description: Description of target: Catalyzes the two-step NADP-dependent conversion of GDP-4-dehydro-6-deoxy-D-mannose to GDP-fucose, involving an epimerase and a reductase reaction.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.172 ng/mL

Polyclonal TSTA3 / FX Antibody (aa221-270)
APR10596G	Leading Biology	0.05ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSTA3 / FX (aa221-270). This antibody is tested and proven to work in the following applications:

GDP-L-Fucose Synthetase (TSTA3) Antibody
20-abx003080	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

GDP-L-Fucose Synthetase (TSTA3) Antibody
abx145521-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

GDP-L-Fucose Synthetase (TSTA3) Antibody
20-abx014493	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	0 1 2 3
Shipped within 5-10 working days.

GDP-L-Fucose Synthetase (TSTA3) Antibody
abx239075-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

TSTA3 sgRNA CRISPR Lentivector set (Human)
K2546601	ABM	3 x 1.0 ug	EUR 339.00

Tsta3 sgRNA CRISPR Lentivector set (Rat)
K6467201	ABM	3 x 1.0 ug	EUR 339.00

Tsta3 sgRNA CRISPR Lentivector set (Mouse)
K4915801	ABM	3 x 1.0 ug	EUR 339.00

Monoclonal TSTA3 Antibody (monoclonal) (M01), Clone: 2B9
APR10598G	Leading Biology	0.1mg	EUR 484.00
Description: A Monoclonal antibody against Human TSTA3 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2B9. This antibody is applicable in WB, E

Tissue Specific Transplantation Antigen P35B (TSTA3) Antibody
20-abx116111	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

GDP-L-Fucose Synthetase (TSTA3) Antibody Pair
abx117457-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010.00
Shipped within 5-10 working days.

Tissue Specific Transplantation Antigen P35B (TSTA3) Antibody
20-abx131052	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	0 1 2 3 4
Shipped within 5-7 working days.

Tissue Specific Transplantation Antigen P35B (TSTA3) Antibody
20-abx131053	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	0 1 2 3 4
Shipped within 5-7 working days.

Tissue Specific Transplantation Antigen P35B (TSTA3) Antibody
20-abx327459	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Tissue Specific Transplantation Antigen P35B (TSTA3) Antibody
abx331219-100ul	Abbexa	100 ul	EUR 425.00
Shipped within 5-10 working days.

Human GDP-L-Fucose Synthase (TSTA3) Antibody
31323-05111	AssayPro	150 ug	EUR 261.00

TSTA3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2546602	ABM	1.0 ug DNA	EUR 154.00

TSTA3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2546603	ABM	1.0 ug DNA	EUR 154.00

TSTA3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2546604	ABM	1.0 ug DNA	EUR 154.00

Tsta3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6467202	ABM	1.0 ug DNA	EUR 154.00

Tsta3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6467203	ABM	1.0 ug DNA	EUR 154.00