TSTA3

TSTA3 siRNA
20-abx938400
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TSTA3 antibody
70R-35685 100 ug
EUR 327.00
Description: Rabbit polyclonal TSTA3 antibody
TSTA3 antibody
70R-21043 50 ul
EUR 435.00
Description: Rabbit polyclonal TSTA3 antibody
TSTA3 antibody
70R-6048 50 ug
EUR 467.00
Description: Rabbit polyclonal TSTA3 antibody raised against the N terminal of TSTA3
TSTA3 Antibody
ABD4085 100 ug
EUR 438.00
TSTA3 Antibody
34703-100ul 100ul
EUR 252.00
TSTA3 Antibody
34703-50ul 50ul
EUR 187.00
TSTA3 antibody
70R-15347 100 ug
EUR 327.00
Description: Rabbit polyclonal TSTA3 antibody
TSTA3 Antibody
DF4085 200ul
EUR 304.00
Description: TSTA3 Antibody detects endogenous levels of total TSTA3.
TSTA3 Antibody
CSB-PA790986-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TSTA3 Antibody
CSB-PA790986-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TSTA3 Antibody
1-CSB-PA00935A0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200
TSTA3 Antibody
1-CSB-PA060020
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
TSTA3 Antibody
1-CSB-PA025200GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
anti-TSTA3
YF-PA15142 50 ul
EUR 363.00
Description: Mouse polyclonal to TSTA3
anti-TSTA3
YF-PA15143 50 ug
EUR 363.00
Description: Mouse polyclonal to TSTA3
anti-TSTA3
YF-PA15144 100 ug
EUR 403.00
Description: Rabbit polyclonal to TSTA3
anti-TSTA3
YF-PA24908 50 ul
EUR 334.00
Description: Mouse polyclonal to TSTA3
Polyclonal TSTA3 Antibody
APR10597G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSTA3 . This antibody is tested and proven to work in the following applications:
TSTA3 Conjugated Antibody
C34703 100ul
EUR 397.00
anti- TSTA3 antibody
FNab09075 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: tissue specific transplantation antigen P35B
  • Uniprot ID: Q13630
  • Gene ID: 7264
  • Research Area: Metabolism
Description: Antibody raised against TSTA3
Mouse Tsta3 Antibody
abx030949-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
Mouse Tsta3 Antibody
abx030949-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
TSTA3 Rabbit pAb
A4169-100ul 100 ul
EUR 308.00
TSTA3 Rabbit pAb
A4169-200ul 200 ul
EUR 459.00
TSTA3 Rabbit pAb
A4169-20ul 20 ul
EUR 183.00
TSTA3 Rabbit pAb
A4169-50ul 50 ul
EUR 223.00
TSTA3 Polyclonal Antibody
A53877 100 µg
EUR 570.55
Description: The best epigenetics products
TSTA3 Blocking Peptide
33R-6023 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSTA3 antibody, catalog no. 70R-6048
TSTA3 antibody (HRP)
60R-1858 100 ug
EUR 327.00
Description: Rabbit polyclonal TSTA3 antibody (HRP)
TSTA3 antibody (FITC)
60R-1859 100 ug
EUR 327.00
Description: Rabbit polyclonal TSTA3 antibody (FITC)
TSTA3 antibody (biotin)
60R-1860 100 ug
EUR 327.00
Description: Rabbit polyclonal TSTA3 antibody (biotin)
TSTA3 Blocking Peptide
DF4085-BP 1mg
EUR 195.00
TSTA3 cloning plasmid
CSB-CL619783HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 966
  • Sequence: atgggtgaaccccagggatccatgcggattctagtgacagggggctctgggctggtaggcaaagccatccagaaggtggtagcagatggagctggacttcctggagaggactgggtgtttgtctcctctaaagacgccgatctcacggatacagcacagacccgcgccctgtttga
  • Show more
Description: A cloning plasmid for the TSTA3 gene.
Anti-TSTA3 antibody
PAab09075 100 ug
EUR 386.00
Anti-TSTA3 antibody
STJ26557 100 µl
EUR 277.00
Description: Tissue specific transplantation antigen P35B is a NADP(H)-binding protein. It catalyze the two-step epimerase and the reductase reactions in GDP-D-mannose metabolism, converting GDP-4-keto-6-D-deoxymannose to GDP-L-fucose. GDP-L-fucose is the substrate of several fucosyltransferases involved in the expression of many glycoconjugates, including blood group ABH antigens and developmental adhesion antigens. Mutations in this gene may cause leukocyte adhesion deficiency, type II.
Anti-TSTA3 (2B9)
YF-MA15950 100 ug
EUR 363.00
Description: Mouse monoclonal to TSTA3
TSTA3 ELISA KIT|Human
EF003915 96 Tests
EUR 689.00
Human TSTA3 shRNA Plasmid
20-abx954964
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
TSTA3 protein (His tag)
80R-1419 100 ug
EUR 305.00
Description: Purified recombinant Human TSTA3 protein
Mouse TSTA3 shRNA Plasmid
20-abx973244
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
TSTA3 Antibody, HRP conjugated
1-CSB-PA00935B0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TSTA3 Antibody, FITC conjugated
1-CSB-PA00935C0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TSTA3 Antibody, Biotin conjugated
1-CSB-PA00935D0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TSTA3 Recombinant Protein (Human)
RP033253 100 ug Ask for price
TSTA3 Recombinant Protein (Rat)
RP235088 100 ug Ask for price
TSTA3 Recombinant Protein (Mouse)
RP181907 100 ug Ask for price
TSTA3 Polyclonal Antibody, HRP Conjugated
A53878 100 µg
EUR 570.55
Description: kits suitable for this type of research
TSTA3 Polyclonal Antibody, FITC Conjugated
A53879 100 µg
EUR 570.55
Description: fast delivery possible
TSTA3 Polyclonal Antibody, Biotin Conjugated
A53880 100 µg
EUR 570.55
Description: reagents widely cited
Tsta3 ORF Vector (Rat) (pORF)
ORF078364 1.0 ug DNA
EUR 506.00
TSTA3 ORF Vector (Human) (pORF)
ORF011085 1.0 ug DNA
EUR 95.00
Tsta3 ORF Vector (Mouse) (pORF)
ORF060637 1.0 ug DNA
EUR 506.00
TSTA3 ELISA Kit (Human) (OKEH03537)
OKEH03537 96 Wells
EUR 779.00
Description: Description of target: Catalyzes the two-step NADP-dependent conversion of GDP-4-dehydro-6-deoxy-D-mannose to GDP-fucose, involving an epimerase and a reductase reaction.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.172 ng/mL
Polyclonal TSTA3 / FX Antibody (aa221-270)
APR10596G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSTA3 / FX (aa221-270). This antibody is tested and proven to work in the following applications:
GDP-L-Fucose Synthetase (TSTA3) Antibody
20-abx003080
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
GDP-L-Fucose Synthetase (TSTA3) Antibody
abx145521-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.
GDP-L-Fucose Synthetase (TSTA3) Antibody
20-abx014493
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
GDP-L-Fucose Synthetase (TSTA3) Antibody
abx239075-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
TSTA3 sgRNA CRISPR Lentivector set (Human)
K2546601 3 x 1.0 ug
EUR 339.00
Tsta3 sgRNA CRISPR Lentivector set (Rat)
K6467201 3 x 1.0 ug
EUR 339.00
Tsta3 sgRNA CRISPR Lentivector set (Mouse)
K4915801 3 x 1.0 ug
EUR 339.00
Monoclonal TSTA3 Antibody (monoclonal) (M01), Clone: 2B9
APR10598G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human TSTA3 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2B9. This antibody is applicable in WB, E
Tissue Specific Transplantation Antigen P35B (TSTA3) Antibody
20-abx116111
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GDP-L-Fucose Synthetase (TSTA3) Antibody Pair
abx117457-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010.00
  • Shipped within 5-10 working days.
Tissue Specific Transplantation Antigen P35B (TSTA3) Antibody
20-abx131052
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.
Tissue Specific Transplantation Antigen P35B (TSTA3) Antibody
20-abx131053
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.
Tissue Specific Transplantation Antigen P35B (TSTA3) Antibody
20-abx327459
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Tissue Specific Transplantation Antigen P35B (TSTA3) Antibody
abx331219-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.
Human GDP-L-Fucose Synthase (TSTA3) Antibody
31323-05111 150 ug
EUR 261.00
TSTA3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2546602 1.0 ug DNA
EUR 154.00
TSTA3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2546603 1.0 ug DNA
EUR 154.00
TSTA3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2546604 1.0 ug DNA
EUR 154.00
Tsta3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6467202 1.0 ug DNA
EUR 154.00
Tsta3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6467203 1.0 ug DNA
EUR 154.00