In den Nachrichten

#biotech

SalomonOliOlivier Salomon@SalomonOli·
1h

Sareum gets patently good news on preclinical drug #BioTech via http://twinybots.ch https://www.proactiveinvestors.co.uk/companies/news/956474/sareum-gets-patently-good-news-on-preclinical-drug-956474.html

Reply on Twitter 1421046251039166465Retweet on Twitter 1421046251039166465Like on Twitter 1421046251039166465Twitter 1421046251039166465
HoldStocksBuyAndHold@HoldStocks·
1h

$HNSA moving up like a clock. Could be a start of cover rally - see price actions at the "acceleration phase". Hansa Biopharma is a top #biotech pick. #finanstwitter #biopharma

Reply on Twitter 1421045673638694921Retweet on Twitter 1421045673638694921Like on Twitter 1421045673638694921Twitter 1421045673638694921
Load More...

TUBAL3

TUBAL3 siRNA
20-abx938557
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TUBAL3 antibody
10R-6174 100 ul
EUR 691.00
Description: Mouse monoclonal TUBAL3 antibody
TUBAL3 antibody
10R-6175 100 ul
EUR 691.00
Description: Mouse monoclonal TUBAL3 antibody
TUBAL3 antibody
10R-6176 100 ul
EUR 691.00
Description: Mouse monoclonal TUBAL3 antibody
TUBAL3 antibody
10R-6177 100 ul
EUR 726.00
Description: Mouse monoclonal TUBAL3 antibody
TUBAL3 antibody
10R-6178 100 ul
EUR 691.00
Description: Mouse monoclonal TUBAL3 antibody
TUBAL3 antibody
10R-6179 100 ul
EUR 691.00
Description: Mouse monoclonal TUBAL3 antibody
TUBAL3 antibody
10R-6180 100 ul
EUR 691.00
Description: Mouse monoclonal TUBAL3 antibody
TUBAL3 antibody
10R-6181 100 ul
EUR 691.00
Description: Mouse monoclonal TUBAL3 antibody
TUBAL3 antibody
10R-7226 100 ul
EUR 691.00
Description: Mouse monoclonal TUBAL3 antibody
TUBAL3 antibody
10R-7227 100 ul
EUR 691.00
Description: Mouse monoclonal TUBAL3 antibody
TUBAL3 Antibody
1-CSB-PA025315LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBAL3. Recognizes TUBAL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
anti-TUBAL3
YF-PA20927 50 ul
EUR 363.00
Description: Mouse polyclonal to TUBAL3
anti-TUBAL3
YF-PA20928 100 ul
EUR 403.00
Description: Rabbit polyclonal to TUBAL3
anti-TUBAL3
YF-PA20929 100 ug
EUR 403.00
Description: Rabbit polyclonal to TUBAL3
TUBAL3 cloning plasmid
CSB-CL025315HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1221
  • Sequence: ATGGATCAGCTGGAAAATGCAAAAATGGAGCACACAAATGCATCTTTCGATACCTTCTTCTGTGAGACAAGAGCTGGGAAGCATGTGCCTAGAGCACTCTTCGTGGACTTGGAGCCAACTGTTATAGATGGGATCCGGACGGGCCAGCACCGTTCACTCTTCCACCCCGAGCAGC
  • Show more
Description: A cloning plasmid for the TUBAL3 gene.
TUBAL3 Polyclonal Antibody
A63728 100 µg
EUR 570.55
Description: kits suitable for this type of research
TUBAL3 Antibody (HRP)
20-abx305829
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
TUBAL3 Antibody (FITC)
20-abx305830
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
TUBAL3 Antibody (Biotin)
20-abx305831
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Human TUBAL3 shRNA Plasmid
20-abx962618
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse TUBAL3 shRNA Plasmid
20-abx982350
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
TUBAL3 Antibody, HRP conjugated
1-CSB-PA025315LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBAL3. Recognizes TUBAL3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TUBAL3 Antibody, FITC conjugated
1-CSB-PA025315LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBAL3. Recognizes TUBAL3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TUBAL3 Antibody, Biotin conjugated
1-CSB-PA025315LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TUBAL3. Recognizes TUBAL3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TUBAL3 Recombinant Protein (Human)
RP044566 100 ug Ask for price
TUBAL3 Recombinant Protein (Rat)
RP235271 100 ug Ask for price
TUBAL3 Recombinant Protein (Mouse)
RP182231 100 ug Ask for price
TUBAL3 Polyclonal Antibody, HRP Conjugated
A63729 100 µg
EUR 570.55
Description: fast delivery possible
TUBAL3 Polyclonal Antibody, FITC Conjugated
A63730 100 µg
EUR 570.55
Description: reagents widely cited
TUBAL3 Polyclonal Antibody, Biotin Conjugated
A63731 100 µg
EUR 570.55
Description: Ask the seller for details
Tubal3 ORF Vector (Rat) (pORF)
ORF078425 1.0 ug DNA
EUR 506.00
TUBAL3 ORF Vector (Human) (pORF)
ORF014856 1.0 ug DNA
EUR 354.00
Tubal3 ORF Vector (Mouse) (pORF)
ORF060745 1.0 ug DNA
EUR 506.00
TUBAL3 sgRNA CRISPR Lentivector set (Human)
K2558001 3 x 1.0 ug
EUR 339.00
Tubal3 sgRNA CRISPR Lentivector set (Mouse)
K3293201 3 x 1.0 ug
EUR 339.00
Tubal3 sgRNA CRISPR Lentivector set (Rat)
K6738401 3 x 1.0 ug
EUR 339.00
Tubulin Alpha Chain-Like 3 (TUBAL3) Antibody
abx145785-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.
Tubulin Alpha Chain-Like 3 (TUBAL3) Antibody
20-abx301309
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
TUBAL3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2558002 1.0 ug DNA
EUR 154.00
TUBAL3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2558003 1.0 ug DNA
EUR 154.00
TUBAL3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2558004 1.0 ug DNA
EUR 154.00
Tubal3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3293202 1.0 ug DNA
EUR 154.00
Tubal3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3293203 1.0 ug DNA
EUR 154.00
Tubal3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3293204 1.0 ug DNA
EUR 154.00
Tubal3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6738402 1.0 ug DNA
EUR 154.00
Tubal3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6738403 1.0 ug DNA
EUR 154.00
Tubal3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6738404 1.0 ug DNA
EUR 154.00
TUBAL3 Protein Vector (Human) (pPB-C-His)
PV059421 500 ng
EUR 481.00
TUBAL3 Protein Vector (Human) (pPB-N-His)
PV059422 500 ng
EUR 481.00
TUBAL3 Protein Vector (Human) (pPM-C-HA)
PV059423 500 ng
EUR 481.00
TUBAL3 Protein Vector (Human) (pPM-C-His)
PV059424 500 ng
EUR 481.00
TUBAL3 Protein Vector (Rat) (pPB-C-His)
PV313698 500 ng
EUR 603.00
TUBAL3 Protein Vector (Rat) (pPB-N-His)
PV313699 500 ng
EUR 603.00
TUBAL3 Protein Vector (Rat) (pPM-C-HA)
PV313700 500 ng
EUR 603.00
TUBAL3 Protein Vector (Rat) (pPM-C-His)
PV313701 500 ng
EUR 603.00
TUBAL3 Protein Vector (Mouse) (pPB-C-His)
PV242978 500 ng
EUR 603.00
TUBAL3 Protein Vector (Mouse) (pPB-N-His)
PV242979 500 ng
EUR 603.00
TUBAL3 Protein Vector (Mouse) (pPM-C-HA)
PV242980 500 ng
EUR 603.00
TUBAL3 Protein Vector (Mouse) (pPM-C-His)
PV242981 500 ng
EUR 603.00
Tubal3 3'UTR GFP Stable Cell Line
TU171356 1.0 ml Ask for price
TUBAL3 3'UTR GFP Stable Cell Line
TU077513 1.0 ml
EUR 1394.00
Tubal3 3'UTR Luciferase Stable Cell Line
TU121356 1.0 ml Ask for price
TUBAL3 3'UTR Luciferase Stable Cell Line
TU027513 1.0 ml
EUR 1394.00
Tubal3 3'UTR Luciferase Stable Cell Line
TU222653 1.0 ml Ask for price
Tubal3 3'UTR GFP Stable Cell Line
TU272653 1.0 ml Ask for price
TUBAL3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV624343 1.0 ug DNA
EUR 682.00
TUBAL3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV624347 1.0 ug DNA
EUR 682.00
TUBAL3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV624348 1.0 ug DNA
EUR 682.00
Human Tubulin alpha chain- like 3, TUBAL3 ELISA KIT
ELI-52873h 96 Tests
EUR 824.00
Mouse Tubulin alpha chain- like 3, Tubal3 ELISA KIT
ELI-46468m 96 Tests
EUR 865.00
TUBAL3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2558005 3 x 1.0 ug
EUR 376.00
Tubal3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3293205 3 x 1.0 ug
EUR 376.00
Tubal3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6738405 3 x 1.0 ug
EUR 376.00
TUBAL3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2558006 1.0 ug DNA
EUR 167.00