CD19-targeting fusion protein combined with PD1 antibody enhances anti-tumor immunity in mouse models.

In our earlier research, utilizing a B cell vaccine (scFv-Her2), the concentrating on of tumor-associated antigen Her2 (human epidermal progress issue receptor-2) to B cells by way of the anti-CD19 single chain variable fragment (scFv) was proven to enhance tumor-specific immunity, which enhanced tumor management in the prophylactic and therapeutic setting. However, the fusion protein displayed restricted exercise in opposition to established tumors, and native relapses usually occurred following scFv-Her2 remedy, indicating that scFv-Her2-induced responses are insufficient to take care of anti-tumor immunity.

 

In this research, concentrating on the IV area (D4) of the extracellular area of Her2 to B cells by way of CD19 molecules (scFv-Her2D4) was discovered to reinforce IFN-γ-producing-CD8+ T cell infiltration in tumor tissues and decreased the variety of tumor-infiltrating myeloid-derived suppressor cells (MDSCs). However, adverse co-stimulatory molecules comparable to programmed cell loss of life protein-1 (PD-1), CD160, and LAG-Three on T cells and programmed loss of life protein ligand-1 (PD-L1) on tumor cells have been upregulated in the tumor microenvironment after scFv-Her2D4 remedy. Further, anti-PD1 administration enhanced the efficacy of scFv-Her2D4 and anti-tumor immunity, as evidenced by the reversal of tumor-infiltrating CD8+ T cell exhaustion and the discount of MDSCs and Treg cells, which suppress T cells and alter the tumor immune microenvironment.

 

Moreover, combining this with anti-PD1 antibodies promoted full tumor rejection. Our knowledge present proof of an in depth interplay amongst tumor vaccines, T cells, and the PD-L1/PD-1 axis and set up a foundation for the rational design of mixture remedy with immune modulators and tumor vaccine remedy.

 CD19-targeting fusion protein combined with PD1 antibody enhances anti-tumor immunity in mouse models.

CD19-targeting fusion protein combined with PD1 antibody enhances anti-tumor immunity in mouse models.

Anti-inflammatory, analgesic exercise, and toxicity of Pituranthos scoparius stem extract: An ethnopharmacological research in rat and mouse fashions.

<AbstractText>Pituranthos scoparius is a medicinal plant that’s used in conventional drugs in Algeria and different North African nations to deal with a number of illnesses comparable to bronchial asthma, rheumatism, measles, dermatoses, jaundice, and digestive problems.</AbstractText><AbstractText>The current investigation was designed to research an ethnobotanical survey about Pituranthos scoparius in Setif area, Algeria, and assess the acute toxicity, in vivo anti-inflammatory potential and analgesic impact of Pituranthos scoparius stem h widespread drugs.</AbstractText><p><div><b>MATERIALS AND METHODS</b></div>Acute toxicity of PSSE was carried out primarily based on OECD pointers 425.
Both potential loss of life and indicators accompanying toxicity of animals have been monitored for 14 days to determine the median deadly dose (LD<sub>50</sub>) of PSSE. Anti-inflammatory impact of the extract was evaluated utilizing the xylene, croton oil-induced ear edema, and carrageenan-induced paw edema, whereas the analgesic exercise was evaluated utilizing acetic acid-induced stomach constriction in mice mannequin.</p><p><div><b>RESULTS</b></div>Data from the ethnopharmacological survey confirmed that 24.47% of individuals used this plant in conventional (people) drugs Results additionally revealed that PSSE comprises excessive quantities of polyphenols, flavonoids, and tannins, and that the extract didn’t trigger any deaths or adjustments in the conduct of handled animals; LD<sub>50</sub> values have been discovered to be greater than 5 g/kg DW.

Mouse Monoclonal Anti-Human CD19 FITC/CD3 PE

CD19-D2-50 50 tests
EUR 651.00

Mouse Monoclonal Anti-Human CD19 FITC/CD5 PE

CD19-D3-50 50 tests
EUR 651.00

Human Cluster Of Differentiation 19 (CD19) ELISA Kit

DLR-CD19-Hu-48T 48T
EUR 498.00
  • Should the Human Cluster Of Differentiation 19 (CD19) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cluster Of Differentiation 19 (CD19) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Cluster Of Differentiation 19 (CD19) ELISA Kit

DLR-CD19-Hu-96T 96T
EUR 647.00
  • Should the Human Cluster Of Differentiation 19 (CD19) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cluster Of Differentiation 19 (CD19) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Cluster Of Differentiation 19 (CD19) ELISA Kit

DLR-CD19-Mu-48T 48T
EUR 508.00
  • Should the Mouse Cluster Of Differentiation 19 (CD19) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cluster Of Differentiation 19 (CD19) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Cluster Of Differentiation 19 (CD19) ELISA Kit

DLR-CD19-Mu-96T 96T
EUR 661.00
  • Should the Mouse Cluster Of Differentiation 19 (CD19) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cluster Of Differentiation 19 (CD19) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Cluster Of Differentiation 19 (CD19) ELISA Kit

DLR-CD19-Ra-48T 48T
EUR 528.00
  • Should the Rat Cluster Of Differentiation 19 (CD19) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cluster Of Differentiation 19 (CD19) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Cluster Of Differentiation 19 (CD19) ELISA Kit

DLR-CD19-Ra-96T 96T
EUR 690.00
  • Should the Rat Cluster Of Differentiation 19 (CD19) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Cluster Of Differentiation 19 (CD19) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Cluster Of Differentiation 19 (CD19) ELISA Kit

RD-CD19-Hu-48Tests 48 Tests
EUR 500.00

Human Cluster Of Differentiation 19 (CD19) ELISA Kit

RD-CD19-Hu-96Tests 96 Tests
EUR 692.00

Mouse Cluster Of Differentiation 19 (CD19) ELISA Kit

RD-CD19-Mu-48Tests 48 Tests
EUR 511.00

Mouse Cluster Of Differentiation 19 (CD19) ELISA Kit

RD-CD19-Mu-96Tests 96 Tests
EUR 709.00

Rat Cluster Of Differentiation 19 (CD19) ELISA Kit

RD-CD19-Ra-48Tests 48 Tests
EUR 534.00

Rat Cluster Of Differentiation 19 (CD19) ELISA Kit

RD-CD19-Ra-96Tests 96 Tests
EUR 742.00

Human Cluster Of Differentiation 19 (CD19) ELISA Kit

RDR-CD19-Hu-48Tests 48 Tests
EUR 522.00

Human Cluster Of Differentiation 19 (CD19) ELISA Kit

RDR-CD19-Hu-96Tests 96 Tests
EUR 724.00

Mouse Cluster Of Differentiation 19 (CD19) ELISA Kit

RDR-CD19-Mu-48Tests 48 Tests
EUR 534.00

Mouse Cluster Of Differentiation 19 (CD19) ELISA Kit

RDR-CD19-Mu-96Tests 96 Tests
EUR 742.00

Rat Cluster Of Differentiation 19 (CD19) ELISA Kit

RDR-CD19-Ra-48Tests 48 Tests
EUR 558.00

Rat Cluster Of Differentiation 19 (CD19) ELISA Kit

RDR-CD19-Ra-96Tests 96 Tests
EUR 776.00

CD19

19A1-100T 100 test
EUR 349.00

CD19

19AC750-100T 100 test
EUR 570.00

CD19

19B1-01MG 100 test
EUR 284.00

CD19

19CFB1-100T 100 test
EUR 388.00

CD19

19F1-100T 100 test
EUR 297.00

CD19

19PC54-100T 100 test
EUR 724.70

CD19

19PC74-100T 100 test
EUR 388.00

CD19

19PE1-100T 100 test
EUR 349.00

CD19

19PP1-100T 100 test
EUR 349.00

CD19

19PPC5.51-100T 100 test
EUR 466.00

CD19

19PU1-01MG 0,1 mg
EUR 219.00

CD19

PR27300 5 ug
EUR 318.00

CD19

MO19A(V100) 100 ug
EUR 50.00

CD19

MO19A(V25) 25 ug
EUR 50.00

CD19

MO19B(V100) 100 ug
EUR 50.00

CD19

MO19B(V25) 25 ug
EUR 50.00

CD19

MO19CFB(V100) 100 ug
EUR 50.00

CD19

MO19CFB(V25) 25 ug
EUR 50.00

CD19

MO19F(V100) 100 ug
EUR 50.00

CD19

MO19F(V25) 25 ug
EUR 50.00

CD19

MO19F(V500) 500 ug
EUR 50.00

CD19

MO19PE(V100) 100 ug
EUR 50.00

CD19

MO19PE(V25) 25 ug
EUR 50.00

CD19

MO19PP(V100) 100 ug
EUR 50.00

CD19

MO19PP(V25) 25 ug
EUR 50.00

CD19

MO19PP5.5(V100) 100 ug
EUR 50.00

CD19

MO19PP5.5(V25) 25 ug
EUR 50.00

CD19

MO19PU(V100) 100 ug
EUR 50.00

CD19

MO19PU(V500) 500 ug
EUR 50.00

B-Lymphocyte Antigen CD19 (CD19) Antibody

abx159376-100ul 100 ul
EUR 356.00
  • Shipped within 5-10 working days.

B-Lymphocyte Antigen CD19 (CD19) Antibody

abx159377-100ul 100 ul
EUR 356.00
  • Shipped within 5-10 working days.

B-Lymphocyte Antigen CD19 (CD19) Antibody

abx159378-100ul 100 ul
EUR 356.00
  • Shipped within 5-10 working days.

B-Lymphocyte Antigen CD19 (CD19) Antibody

abx159379-100ul 100 ul
EUR 356.00
  • Shipped within 5-10 working days.

B-Lymphocyte Antigen CD19 (CD19) Antibody

abx159380-100ul 100 ul
EUR 439.00
  • Shipped within 5-10 working days.

B-Lymphocyte Antigen CD19 (CD19) Antibody

abx159381-100ul 100 ul
EUR 356.00
  • Shipped within 5-10 working days.

B-Lymphocyte Antigen CD19 (CD19) Antibody

abx011636-100ul 100 ul
EUR 411.00
  • Shipped within 5-10 working days.

Human B-lymphocyte antigen CD19 (CD19)

1-CSB-CF004888HU
  • EUR 1298.00
  • EUR 682.00
  • EUR 798.00
  • 0
  • 1
  • 2
  • MW: 34.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human B-lymphocyte antigen CD19(CD19),partial expressed in in vitro E.coli expression system

Human B-lymphocyte antigen CD19 (CD19)

1-CSB-CF004888HUc7
  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 0
  • 1
  • 2
  • MW: 30.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human B-lymphocyte antigen CD19(CD19),partial expressed in in vitro E.coli expression system

CD19 Antibody

AF6181 200ul
EUR 304.00
Description: CD19 Antibody detects endogenous levels of total CD19.

CD19 Antibody

BF0411 200ul
EUR 376.00
Description: CD19 antibody detects endogenous levels of total CD19.

CD19 Antibody

ABF6181 100 ug
EUR 438.00

CD19 siRNA

20-abx910940
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CD19 siRNA

20-abx910941
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CD19 antibody

70R-49501 100 ul
EUR 287.00
Description: Purified Polyclonal CD19 antibody

CD19 antibody

70R-30866 100 ug
EUR 327.00
Description: Rabbit polyclonal CD19 antibody

CD19 Antibody

ABD7030 100 ug
EUR 438.00

CD3/CD19

3F119PE1-50T 50 test
EUR 350.30

CD19 Antibody

49388-100ul 100ul
EUR 333.00

CD19 Antibody

49388-50ul 50ul
EUR 239.00

CD19 Antibody

49407-100ul 100ul
EUR 333.00

CD19 Antibody

49407-50ul 50ul
EUR 239.00

CD19 antibody

10R-6362 100 ug
EUR 170.00
Description: Rat monoclonal CD19 antibody

CD19 antibody

10R-CD19aMS 500 ug
EUR 413.00
Description: Rat monoclonal CD19 antibody

CD19 antibody

10R-CD19bHU 100 ug
EUR 262.00
Description: Mouse monoclonal CD19 antibody

CD19 antibody

10R-CD19cHU 100 ug
EUR 241.00
Description: Mouse monoclonal CD19 antibody

CD19 antibody

10R-CD19dMS 500 ug
EUR 403.00
Description: Mouse monoclonal CD19 antibody

CD19 Antibody

32727-100ul 100ul
EUR 252.00

CD19 antibody

10R-1794 100 ul
EUR 241.00
Description: Mouse monoclonal CD19 antibody

CD19 antibody

10R-1895 100 ul
EUR 381.00
Description: Mouse monoclonal CD19 antibody

CD19 antibody

10R-3608 100 ul
EUR 691.00
Description: Mouse monoclonal CD19 antibody

CD5/CD19

5F19PE1-50T 50 test
EUR 350.30

CD19 Antibody

DF7030 200ul
EUR 304.00
Description: CD19 Antibody detects endogenous levels of total CD19.

CD19 Antibody

1-CSB-PA001431
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CD19. Recognizes CD19 from Human, Mouse, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CD19 Antibody

1-CSB-PA006159
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CD19. Recognizes CD19 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

KAPPA/CD19

KAPPAF219PE1-50T 50 test
EUR 350.30

KAPPA/CD19

KF319PE4-50T 50 test
EUR 466.00

CD19 antibody

PAab09868 100 ug
EUR 386.00

LAMBDA/CD19

LAMBDAF19PE1-50T 50 test
EUR 350.30

LAMBDA/CD19

LF219PE4-50T 50 test
EUR 466.00

pCMV6- CD19

PVT10226 2 ug
EUR 301.00

anti-CD19

YF-PA10772 100 ug
EUR 403.00
Description: Rabbit polyclonal to CD19

anti-CD19

YF-PA23389 50 ul
EUR 334.00
Description: Mouse polyclonal to CD19

Recombinant Cynomolgus CD19/CD19 Molecule (C-Fc)

CW08-10ug 10ug
EUR 202.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Cynomolgus CD19/CD19 Molecule (C-Fc)

CW08-1mg 1mg
EUR 3298.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Cynomolgus CD19/CD19 Molecule (C-Fc)

CW08-500ug 500ug
EUR 2323.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Cynomolgus CD19/CD19 Molecule (C-Fc)

CW08-50ug 50ug
EUR 496.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Mouse B-Lymphocyte Antigen CD19 (CD19) ELISA Kit

abx570286-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Human B-Lymphocyte Antigen CD19 (CD19) ELISA Kit

abx572501-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Mouse Cd19/ B-lymphocyte antigen CD19 ELISA Kit

E0242Mo 1 Kit
EUR 571.00

Human CD19/ B-lymphocyte antigen CD19 ELISA Kit

E2752Hu 1 Kit
EUR 571.00

Human B- lymphocyte antigen CD19, CD19 ELISA KIT

ELI-06013h 96 Tests
EUR 824.00

Mouse B- lymphocyte antigen CD19, Cd19 ELISA KIT

ELI-06014m 96 Tests
EUR 865.00

Mouse B-Lymphocyte Antigen CD19 (CD19) ELISA Kit

20-abx153798
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Rat B-Lymphocyte Antigen CD19 (CD19) ELISA Kit

20-abx155323
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Human B-Lymphocyte Antigen CD19 (CD19) ELISA Kit

20-abx150992
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Human B-Lymphocyte Antigen CD19 (CD19) ELISA Kit

abx352417-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Mouse B-Lymphocyte Antigen CD19 (CD19) ELISA Kit

abx255037-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

CD19 Blocking Peptide

AF6181-BP 1mg
EUR 195.00

CD19 Conjugated Antibody

C49388 100ul
EUR 397.00

CD19 Blocking Peptide

BF0411-BP 1mg
EUR 195.00

CD19 cloning plasmid

CSB-CL004888HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1671
  • Sequence: atgccacctcctcgcctcctcttcttcctcctcttcctcacccccatggaagtcaggcccgaggaacctctagtggtgaaggtggaagagggagataacgctgtgctgcagtgcctcaaggggacctcagatggccccactcagcagctgacctggtctcgggagtccccgctta
  • Show more
Description: A cloning plasmid for the CD19 gene.

FMC7/CD23/CD19

FMC7F23PE19PP1-100T 100 test
EUR 1103.00

anti- CD19 antibody

FNab09868 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: CD19
  • Uniprot ID: P15391
  • Gene ID: 930
  • Research Area: Stem Cells, Immunology, Signal Transduction, Cancer
Description: Antibody raised against CD19

CD19 Polyclonal Antibody

ES1899-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against CD19 from Human/Mouse/Monkey. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

CD19 Polyclonal Antibody

ES1899-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against CD19 from Human/Mouse/Monkey. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

CD19 Polyclonal Antibody

ES4310-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against CD19 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CD19 Polyclonal Antibody

ES4310-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against CD19 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CD19 (pY500) Antibody

abx149056-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

CD19 Blocking Peptide

20-abx061913
  • EUR 258.00
  • EUR 384.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CD19 Polyclonal Antibody

ABP50900-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from human CD19 around the non-phosphorylation site of Y531
  • Applications tips:
Description: A polyclonal antibody for detection of CD19 from Human, Mouse, Monkey. This CD19 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human CD19 around the non-phosphorylation site of Y531
Additionally, no important variations have been noticed in the alkaline phosphatase (ALP), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) enzymes, or in the degrees of urea and creatinine. Oral administration of PSSE on the doses of 100, 300, and 600 mg/kg produced a big dose-dependent inhibition impact in each xylene and croton oil-induced ear edema in mice. Administration of PSSE at a dose of 100, 250, and 500 mg/kg considerably (P ˂ 0.05) exhibited anti-edematogenic impact in the carrageenan-induced rat paw edema after Three h.